معلومة

كيف يتم تحويل الحمض النووي الريبي للفيروس القهقري إلى [كدنا]؟

كيف يتم تحويل الحمض النووي الريبي للفيروس القهقري إلى [كدنا]؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

يحتوي الفيروس القهقرى (oncovirus) على الحمض النووي الريبي. يحتوي أيضًا على جزيء يسمى النسخ العكسي. يقوم هذا الجزيء بنسخ الحمض النووي الريبي إلى (كدنا). هذا (كدنا) هو نسخة DNA من جينوم الحمض النووي الريبي الفيروسي

يحتوي الحمض النووي الريبي على اليوراسيل بدلاً من الثايمين ، بينما يحتوي الحمض النووي على الثايمين بدلاً من اليوراسيل. إذن ، كيف يمكن تحويل الحمض النووي الريبي إلى حمض نووي؟ أين يذهب Uracil ومن أين يأتي الثايمين؟


يحتوي الحمض النووي الريبي على اليوراسيل بدلاً من الثايمين ، بينما يحتوي الحمض النووي على الثايمين بدلاً من اليوراسيل. إذن ، كيف يمكن تحويل الحمض النووي الريبي إلى حمض نووي؟

أعتقد أنك قد ترغب في طرح سؤال أساسي أكثر. الحمض النووي والحمض النووي الريبي متشابهان للغاية ، مع اختلاف الأكسجين فقط. هذا له عواقب وخيمة على الكائنات الحية ، والحياة كما نعرفها تستخدم الحمض النووي والحمض النووي الريبي لأغراض منفصلة للغاية. يخزن الحمض النووي الجينوم الذي يوفر التعليمات للحياة ، والحمض النووي الريبي باختصار هو كيفية تحويل هذه الرسالة إلى بروتين للقيام بعمل مفيد. إن الحمض النووي الريبي عمومًا أقل استقرارًا من الحمض النووي ، لذا فإن هذا الترتيب يعمل جيدًا.

يتم نسخ الحمض النووي بانتظام وباستمرار إلى الحمض النووي الريبي ، لذلك يستخدم الثايمين بانتظام لصالح اليوراسيل. هناك رائع أجب هنا على Biology.SE تتعامل بالفعل مع لماذا لذلك أقترح قراءة ذلك. ال كيف إنه أمر بسيط ومباشر ، فهناك جزيئات مختلفة مستخدمة! تشتمل بوليمرات الحمض النووي على الثايمين بينما تشتمل بوليمرات الحمض النووي الريبي على اليوراسيل. يقوم النسخ العكسي الذي تم ترميزه بواسطة الفيروسات القهقرية بهذا فقط: يقوم بنسخ الحمض النووي الريبي إلى الحمض النووي ، باستخدام الثايمين بدلاً من اليوراسيل. يوجد كل من اليوراسيل والثايمين في الخلية وبالتالي فهي متاحة للاستخدام.


أعتقد أنه قد يكون مفيدًا لتوضيح الفرق بين اليوراسيل والثايمين

إنها هياكل متشابهة جدًا. الجزء الذي يشارك في الاقتران الأساسي هو في الواقع النيتروجين والأكسجين الأبعد عن السكر. انظر أدناه:

لذا فإن وجود مجموعة ميثيل إضافية على الجانب الآخر من الجزيء لا يقطع عملية الربط القاعدي. وتذكر ، باستخدام تخليق DNA / RNA ، يكون لديك قالب ، ويعتمد الخيط الجديد على القالب. لذلك ، عندما يذكر إنزيم RT مدحت الأدينين في قالب الحمض النووي الريبي ، فإنه سيقرنه مع الثيميدين. وعندما يصادف اليوراسيل ، يكون قادرًا على إقرانه بالأدينين. تم تصميم الإنزيم خصيصًا للسماح فقط بالثيمين وليس اليوراسيل ، وهذا هو سبب التمييز.


توليف (كدنا)

مهما كانت متطلباتك ، هناك مجموعة تصنيع Bio-Rad cDNA التي تلبي احتياجاتك.

الاعتماد حدد توليف (كدنا)
عدة

حدد مجموعة Reliance Select cDNA Synthesis Kit لالتقاط الأهداف الغنية بالـ GC والهيكل الثانوي في FFPE والعينات الصعبة مع الحمض النووي الريبي المتدهور أو المثبطات.

النسخ العكسي Supermix
ل RT-qPCR

اختر iScript النسخ العكسي supermix لتوليف cDNA سريع وفعال وحساس لـ RT-qPCR & ndash أنبوب واحد وبروتوكول 40 دقيقة.

طقم توليف (كدنا) المتقدم
ل RT-qPCR

اختر iScript Advanced cDNA Synthesis Kit التي لها نطاق ديناميكي ممتد بسعة تصل إلى 7.5 و microg إدخال RNA.


كيف يتم تحويل الحمض النووي الريبي للفيروس القهقري إلى [كدنا]؟ - مادة الاحياء

يسمح لنا هذا الإنزيم العكسي باستخدام قالب RNA لإنتاج نسخة cDNA مزدوجة تقطعت بهم السبل. تم اكتشاف النسخ العكسي بواسطة H. Temin و D. Baltimore أثناء دراسة الفيروسات القهقرية. تحتوي الفيروسات القهقرية على جينوم الحمض النووي الريبي الذي يتم تحويله إلى نسخة من الحمض النووي ودمجه في جينوم المضيف أثناء دورته التكاثرية. هذه مجموعة مثيرة للاهتمام من الفيروسات بما في ذلك العديد من فيروسات الورم وفيروس الإيدز HIV.

إن إنزيم النسخ العكسي هو بوليميريز DNA المعتمد على الحمض النووي الريبي. إنه يستخدم الحمض النووي الريبي كقالب ، ويتطلب dNTPs وبادئ (مجاني 3 'OH) لبدء بلمرة الحمض النووي.

يشيع استخدام نوعين من البرايمر.

يبدأ Oligo-dT التحضير من نهاية 3 'من mRNAs.
يتم إثراء (كدنا) معدة مع oligo-dT لنهايات mRNA 3.

يمكن أن تتهجين قليل النوكليوتيدات العشوائية في أي مكان على طول تسلسل الرنا المرسال والتوليف الأولي للـ كدنا. يتم توزيع (كدنا) معدة عشوائيا على طول القالب وبالتالي فهي أكثر تمثيلا من السكان مرنا.

عادة ما تكون mRNAs قصيرة (بالمقارنة مع الجينوم) - معظم mRNAs يقل طولها عن 6 كيلو بايت وفقط mRNA النادر يتجاوز 10 كيلو بايت في الطول.
هذا الحجم الصغير يعني أن كلاً من نواقل إدخال البلازميد والعاثية مناسبة لبناء مكتبات (كدنا)
(على عكس المكتبات الجينومية حيث تفضل نواقل استبدال الملتهمة).

في مناقشتنا لمكتبات الجينوم ، ركزنا على التغطية الكاملة للجينوم.
تم إنشاء شظايا جينومية عشوائية عن طريق الهضم الجزئي مع إنزيم قطع متكرر.
تحتوي مكتبة البنادق العشوائية الناتجة على نسخ متعددة متداخلة تغطي تسلسل الجينوم الكامل.

مكتبات cDNA مختلفة قليلاً.
هنا يمثل كل محول بكتيري أو فجائي معبأ جزيء مرنا فريدًا.
تمثل المواد المؤتلفة التي تحتوي على نفس تسلسل الحمض النووي جزيئات قالب مختلفة موجودة في مجموعة الرنا المرسال الأصلية.

على سبيل المثال ، هناك 100000 جزيء من جزيئات الرنا المرسال في الخلية في وقت معين
10٪ منهم عبارة عن جزيئات mRNA عالية التعبير (دعنا نقول أكتين mRNAs)
ثم في مكتبة (كدنا) أولية تتكون من 100000 نسخة ،
10 ٪ منهم (10000) سيكونون أكتين (كدنا).
أو يمكنك فقط فحص اثنين من cDNAs الخفية وما زلت تجد أكتين cDNAs.

حسنًا ، هذا لطيف جدًا إذا كنت تريد دراسة الأكتين.

ماذا لو كنت ترغب في دراسة بعض عوامل النسخ النادرة التي يتم التعبير عنها فقط عند مستويات منخفضة.
في 100،000 mRNAs الخاصة بك ، قد يكون هناك 10 mRNAs فقط ترميز عامل النسخ الخاص بك.
الآن سوف تضطر إلى فحص مكتبتك بالكامل المكونة من 100000 نسخة.

إذا تم التعبير عن نصك لفترة قصيرة فقط بمستويات منخفضة ، فقد يكون موجودًا في مستويات أقل.

غالبية الملتهمة المؤتلفة في مكتبة cDNA القياسية تحمل تسلسلات معبرة للغاية.
يصعب العثور على mRNAs النادرة ما لم تكن مكتبتك كبيرة جدًا (عدد المؤتلفات - يجب أن تحتوي على أكثر من 10 6 مواد مؤتلفة مستقلة لتغطية مجموعة mRNA من 100000 نسخة مع احتمال 99٪).

البديل لفحص الأعداد المتزايدة من المؤتلف المستقل هو "تطبيع" المكتبة باستخدام حركيات التهجين كما ناقشنا سابقًا.
تحتوي المكتبات التي تمت تسويتها على عدد أقل من نسخ mRNAs المعبر عنها بدرجة عالية (تمت إزالتها عند التهجين) والمزيد من نسخ النصوص النادرة (بالمعنى النسبي).


الفيروسات القهقرية

سيراجع محررونا ما قدمته ويحددون ما إذا كان ينبغي مراجعة المقالة أم لا.

الفيروسات القهقرية، أي مجموعة من الفيروسات التي تنتمي إلى عائلة Retroviridae والتي تحمل بشكل مميز مخططها الوراثي على شكل حمض الريبونوكليك (RNA). تمت تسمية الفيروسات القهقرية على اسم إنزيم يعرف باسم النسخ العكسي ، والذي تم اكتشافه بشكل مستقل في عام 1971 من قبل علماء الفيروسات الأمريكيين هوارد تيمين وديفيد بالتيمور. يقوم النسخ العكسي بنسخ الحمض النووي الريبي إلى الحمض النووي الريبي منقوص الأكسجين (DNA) ، وهي عملية تشكل انعكاسًا للاتجاه المعتاد للنسخ الخلوي (DNA إلى RNA). يجعل عمل النسخ العكسي من الممكن للمواد الجينية من الفيروسات القهقرية أن يتم دمجها بشكل دائم في جينوم الحمض النووي للخلية المصابة ، ويستخدم الإنزيم على نطاق واسع في العلوم البيولوجية لتخليق الجينات.

تسبب الفيروسات القهقرية نمو الورم وأنواع معينة من السرطان في الحيوانات وترتبط بالعدوى البطيئة للحيوانات ، مثل فقر الدم المعدي للخيول. في البشر ، تسبب الفيروسات القهقرية المعروفة باسم الفيروس اللمفاوي للخلايا التائية البشرية من النوع 1 (HTLV-1) شكلاً من أشكال السرطان يسمى ابيضاض الدم بالخلايا التائية البالغة (ATL). يمكن أن يسبب أيضًا حالة تنكسية عصبية تعرف باسم اعتلال النخاع الشوكي المرتبط بـ HTLV-1 / الشلل التشنجي الاستوائي (HAM / TSP). يرتبط فيروس وثيق الصلة يسمى HTLV-2 باضطرابات عصبية خفيفة نسبيًا ولكن لم يتم تحديده كعامل مسبب لمرض يصيب الإنسان. يُعتقد أن ما يصل إلى 20 مليون شخص في جميع أنحاء العالم مصابون بـ HTLVs ، لكن نسبة صغيرة فقط من الأفراد المصابين يصابون بالفعل بـ ATL أو HAM / TSP. يتسبب الفيروس القهقري المعروف باسم فيروس نقص المناعة البشرية (HIV) في الإصابة بمتلازمة نقص المناعة المكتسب (الإيدز) في البشر. يرتبط فيروس نقص المناعة البشرية ارتباطًا وثيقًا بفيروس نقص المناعة القرد (SIV) ، وهو فيروس ارتجاعي موجود في الشمبانزي والغوريلا.

ما يسمى بالفيروسات القهقرية الذاتية (ERVs) هي سمات ثابتة لجينومات العديد من الحيوانات. تتكون فيروسات النسخ العكسي من المادة الجينية للفيروسات المنقرضة أو "الأحفورية" ، والتي يشبه تكوينها الجينومي تكوين الفيروسات القهقرية الموجودة. تم توزيع الفيروسات البشرية (HERVs) داخل الحمض النووي البشري على مدار التطور. يتم تمريرها من جيل إلى آخر وتشكل ما يقدر بنحو 1 إلى ما يقرب من 5 في المائة من الجينوم البشري. يُشتبه في أن HERVs أثرت في تطور بعض عناصر الجينوم البشري. كما أنها متورطة في بعض الأمراض البشرية ، بما في ذلك التصلب المتعدد.

كان HTLV-1 أول فيروس ارتجاعي بشري يتم اكتشافه ، بعد أن تم اكتشافه وعزله في عام 1979 من قبل عالم الفيروسات الأمريكي روبرت سي جالو وزملاؤه. تم عزل فيروس نقص المناعة البشرية لأول مرة في عام 1983.


الانتشار الواسع والأدوار البيولوجية المحتملة للعناصر الفيروسية الذاتية المنشأ في جينومات الحشرات

كشفت مناهج التسلسل الجينومي الحديث والمعلوماتية الحيوية عن العديد من الأمثلة على تسلسل الحمض النووي المستمدة من جينومات الحمض النووي الريبي والفيروسات المدمجة في جينومات كل من الفقاريات والحشرات. تقوم الفيروسات القهقرية بتشفير بوليميراز الحمض النووي المعتمد على الحمض النووي الريبي (النسخ العكسية) والعبارات التي تحول جينومات RNA الفيروسية إلى فيروسات الحمض النووي وتسهل تكامل الحمض النووي الأولي في جينوم المضيف. والمثير للدهشة أن تسلسل الحمض النووي المشتق من فيروسات الحمض النووي الريبي الذي لا يشفر هذه الإنزيمات تحدث أيضًا في جينومات المضيف. تحدث متواليات فيروسات الحمض النووي الريبي المتكاملة غير الفيروسية (NIRVS) بتردد مرتفع نسبيًا في جينومات ناقلات الفيروسة الفيروسية الزاعجة المصرية و الزاعجة البيضاء، لا يتم توزيعها بشكل عشوائي وربما تساهم في مناعة البعوض المضادة للفيروسات ، مما يشير إلى أن هذه البعوض يمكن أن تكون بمثابة نظام نموذجي لكشف وظيفة NIRVS. هنا نتناول الأسئلة التالية: ما الذي يدفع تخليق الحمض النووي من جينومات فيروسات الحمض النووي الريبي غير الفيروسية؟ كيف يحدث تكامل الفيروس (كدنا) في الحمض النووي للمضيف ، وما هي وظيفته البيولوجية (إن وجدت)؟ نقوم بمراجعة المعرفة الحالية للتكامل الفيروسي في جينومات الحشرات ، ونفترض آليات تكوين NIRVS وتأثيرها المحتمل على بيولوجيا الحشرات ، وخاصة المناعة المضادة للفيروسات ، ونقترح اتجاهات للبحث في المستقبل.


الفيروسات القهقرية `` عمرها حوالي نصف مليار سنة ''

يحتوي الفيروس الارتجاعي على غشاء يحتوي على بروتينات سكرية ، قادرة على الارتباط ببروتين مستقبِل في الخلية المضيفة. هناك نوعان من سلاسل الحمض النووي الريبي داخل الخلية التي تحتوي على ثلاثة إنزيمات: البروتياز ، والنسخة العكسية ، والإنزيم المدمج (1). الخطوة الأولى للنسخ المتماثل هي ربط البروتين السكري ببروتين المستقبل (2). بمجرد أن يتم ربطها ، يتحلل غشاء الخلية ، ويصبح جزءًا من الخلية المضيفة ، وتدخل خيوط RNA والإنزيمات إلى الخلية (3). داخل الخلية ، يخلق النسخ العكسي شريطًا مكملًا من الحمض النووي من الحمض النووي الريبي للفيروس القهقري ويتحلل الحمض النووي الريبي ، ويُعرف هذا الشريط من الحمض النووي باسم cDNA (4). ثم يتم نسخ (كدنا) ، ويشكل الخيطان رابطة ضعيفة ويدخلان إلى النواة (5). مرة واحدة في النواة ، يتم دمج الحمض النووي في الحمض النووي للخلية المضيفة بمساعدة Integrase (6). يمكن أن تظل هذه الخلية خامدة ، أو يمكن تصنيع الحمض النووي الريبي من الحمض النووي واستخدامه لإنشاء البروتينات لفيروس قهقري جديد (7). تُستخدم وحدات الريبوسوم لنسخ الرنا المرسال للفيروس إلى تسلسلات الأحماض الأمينية التي يمكن تحويلها إلى بروتينات في الشبكة الإندوبلازمية الخشنة. ستعمل هذه الخطوة أيضًا على صنع الإنزيمات الفيروسية والبروتينات القفيصة (8). سيتم تصنيع الحمض النووي الريبي الفيروسي في النواة. يتم بعد ذلك تجميع هذه القطع معًا ويتم ضغطها من غشاء الخلية كفيروس قهقري جديد (9). الائتمان: Wikipedia / CC BY-SA 3.0

يبلغ عمر الفيروسات القهقرية - عائلة الفيروسات التي تشمل فيروس نقص المناعة البشرية - ما يقرب من نصف مليار سنة ، وفقًا لبحث جديد أجراه علماء في جامعة أكسفورد. يعد هذا بمئات الملايين من السنين أقدم مما كان يعتقد سابقًا ، ويشير إلى أن الفيروسات القهقرية لها أصول بحرية قديمة ، حيث كانت مع مضيفيها من الحيوانات من خلال الانتقال التطوري من البحر إلى الأرض.

النتائج المنشورة في المجلة اتصالات الطبيعة، سيساعدنا على فهم المزيد عن "سباق التسلح" المستمر بين الفيروسات ومضيفيها.

قال مؤلف الدراسة الدكتور أريس كاتزوراكيس ، من قسم علم الحيوان بجامعة أكسفورد: "لم يُعرف سوى القليل جدًا عن الأصل القديم للفيروسات القهقرية ، ويرجع ذلك جزئيًا إلى عدم وجود سجلات الحفريات الجيولوجية. تنتشر الفيروسات القهقرية على نطاق واسع بين الفقاريات ويمكنها أيضًا الانتقال بين المضيفين ، مما أدى إلى أمراض جديدة مثل فيروس نقص المناعة البشرية ، وقد ثبت أنها قادرة على القفز بين مضيفين قريبين مثل الطيور والثدييات. ولكن حتى الآن ، كان يُعتقد أن الفيروسات القهقرية كانت قادمة نسبيًا - ربما حتى 100 مليون سنة في سن.

"يُظهر بحثنا الجديد أن الفيروسات القهقرية يبلغ عمرها 450 مليون سنة على الأقل ، إن لم يكن أقدم ، ويجب أن تكون قد نشأت جنبًا إلى جنب ، إن لم يكن من قبل ، مضيفاتها الفقارية في أوائل عصر الباليوزويك. علاوة على ذلك ، كانت موجودة في عصرنا القديم. أسلاف الفقاريات قبل استعمار الأرض ورافقوا مضيفيهم طوال هذا الانتقال من البحر إلى الأرض ، حتى يومنا هذا ".

الفيروسات القهقرية هي عائلة من الفيروسات التي تشمل فيروس نقص المناعة البشرية المسؤول عن وباء الإيدز. يمكن أن تسبب أيضًا سرطانات ونقص المناعة في مجموعة من الحيوانات. يأتي الجزء "الرجعي" من اسمهم من حقيقة أنهم مصنوعون من الحمض النووي الريبي (RNA) ، والذي يمكنهم تحويله إلى DNA وإدخاله في جينوم مضيفهم - وهو الاتجاه المعاكس للتدفق الطبيعي للمعلومات في الخلية. تعني هذه الخاصية أنه يمكن توريثها في بعض الأحيان كفيروسات قهقرية داخلية (فيروسات قهقرية ذات أصل داخلي) ، وتشكل سجل أحفوري جيني افتراضي يمكن استخدامه للنظر إلى الوراء في تاريخها التطوري.

استخدم هذا البحث تسلسلات الجينوم من الفيروسات القهقرية الداخلية التي تشبه الفيروسات "الرغوية" - وهي مجموعة من الفيروسات تميل إلى التباعد جنبًا إلى جنب مع مضيفيها. تنتشر الفيروسات الرغوية على نطاق واسع في الثدييات ، وفي هذه الدراسة اكتشف الباحثون الحفريات الجينية للفيروسات القهقرية الشبيهة بالرغوة في مضيفين متنوعين للغاية ، بما في ذلك الأسماك ذات الزعانف والبرمائيات التي لم يتم العثور عليها من قبل.

خلال هذه الدراسة ، تغلب الباحثون على أحد القيود الرئيسية في دراسة التاريخ التطوري العميق للفيروسات: تطورها السريع. تسهل هذه السمة إعادة بناء التاريخ الحديث للفيروسات ولكنها تحجب ماضيها البعيد. ومع ذلك ، فإن النموذج الجديد المستخدم في هذا البحث - بالاقتران مع سجلات الحفريات الجينومية للفيروسات الشبيهة بالرغوة - سمح للعلماء بتفسير التباطؤ الواضح في معدل التطور كلما ذهبوا إلى الوراء.

وأضاف الدكتور كاتزوركيس: "تُظهر هذه النتائج أن هذه المجموعة المهمة طبيًا من الفيروسات يبلغ عمرها على الأقل نصف مليار سنة - أقدم بكثير مما كان يعتقد سابقًا. وهي تعود إلى أصول الفقاريات ، وهذا يعطينا السياق الذي يجب أن نأخذ في الاعتبار نشاطهم الحالي وتفاعلاتهم مع مضيفيهم. على سبيل المثال ، نحتاج إلى النظر في التكيفات التي طورتها الفقاريات لمكافحة الفيروسات ، والتدابير المضادة الفيروسية المناظرة ، كنتاج لسباق تسلح مستمر يمتد إلى مئات ملايين السنين.

"يتزامن تاريخنا المستنتج من أصول الفيروسات القهقرية مع أصول المناعة التكيفية ، وبالتالي فمن المحتمل أن تكون الفيروسات القهقرية قد لعبت دورًا مهمًا في ظهور هذه الأداة الرئيسية في الدفاع المضاد للفيروسات لدى الفقاريات. كما نفهم طبيعة التفاعل بين الفيروسات ومناعة المضيف ، سنكون في وضع أفضل للتدخل في سباق التسلح المتوازن بدقة من أجل تطوير علاجات وتدخلات جديدة.

"وبينما نبني صورة أوضح لأصول المجموعات المتنوعة من الفيروسات التي تصيبنا اليوم ، يجب أن نقترب أكثر لكشف لغز أصولها النهائية."


المكونات المستخدمة في RT-qPCR:

يعد اختيار مكونات النسخ العكسي PCR أمرًا بالغ الأهمية مثل اختيار ظروف درجة الحرارة ولكن لا تقلق بشأن ذلك ، تحتوي مجموعة PCR الجاهزة للاستخدام النسخ العكسي على جميع المكونات في مخزن التفاعل وخليط التفاعل.

إن اختيار كل مكون من مكونات تفاعل البوليميراز المتسلسل وكميته لا يقل أهمية عن اختيار ظروف درجة حرارة تفاعل البوليميراز المتسلسل. في الوقت الحاضر ، فإن مجموعات PCR الجاهزة لاستخدام النسخ العكسي تجعل عملك فعالًا لأنه يحتوي على كل مكون فيه. دعونا نرى بعض مكونات RT-PCR ،

  • إنزيم النسخ العكسي مع نشاط RNase
  • RNase H (إذا كان النسخ العكسي لا يحتوي عليه)
  • بوليميريز الحمض النووي

الملخص

تحمل العديد من الفيروسات أكثر من جزء واحد من الحمض النووي إلى جسيم الفيروس ، لكن الفيروسات القهقرية هي المجموعة الوحيدة المعروفة من الفيروسات التي تحتوي على نسختين متطابقتين (أو متطابقتين تقريبًا) من جينوم الحمض النووي الريبي داخل الفيروس. ترتبط جينومات الحمض النووي الريبي (RNA) هذه معًا بشكل غير تساهمي من خلال عملية تُعرف باسم dimerization RNA الجينومي. بشكل فريد ، فإن تناقص الحمض النووي الريبي للجينوم الفيروسي له أهمية حاسمة في التكاثر الفعال للفيروسات القهقرية. في هذه المقالة ، تتم مراجعة فهمنا الحالي للعلاقة بين تشكّل الجينوم الفيروسي وتقليل حجمه وتكراره.


الخطوة 7: تحليل البيانات

أ- تطبيع البيانات & # x02014 المقارنة جف طريقة

تم التأكيد بشكل متكرر على أهمية تطبيع بيانات qPCR [1 ، 26]. يعد تطبيع البيانات خطوة حاسمة في سير عمل qPCR ، حيث إنه يصحح الاختلافات في خطوات متعددة ، بما في ذلك تنقية الحمض النووي الريبي ، وتقييم تركيز الحمض النووي الريبي ، وكذلك النسخ العكسي وكفاءة التضخيم. التطبيع مع جينات مرجعية معبر عنها بثبات مثل الضوابط الداخلية ، والمعروفة باسم C المقارنف أو & # x00394 & # x00394Cف الطريقة ، هي الطريقة الأكثر شيوعًا لتطبيع بيانات الرنا المرسال. ومع ذلك ، تتطلب هذه التقنية التحقق المناسب للتأكد من تنفيذها بشكل صحيح [27]. للمقارنة Cف لكي تكون صالحة ، من المهم التأكد من أن الجينات المرجعية والجينات المستهدفة لها كفاءة تضخيم مماثلة ، مثل C مقارنة صالحةف تعتمد الطريقة على افتراض إضافي لكفاءة تضخيم مماثلة [28]. يمكن رسم منحنى قياسي لـ & # x00394Cف (الفرق بين الجين المرجعي والهدف مقابل سجل إدخال cDNA) ، والقيمة المطلقة للمنحدر يجب أن تكون & # x0003c0.1 [29]. شاهد مثالاً على & # x00394Cف ما بين سيكلوفيلين و PGC-1 & # x003b1 في الشكل 6. إذا لم يكن من الممكن الحصول على جينات مرجعية ذات كفاءة تضخيم مماثلة للهدف ، يُقترح استخدام طريقة Pfaffl للحساب ، حيث يتم تعديل الحساب من خلال الاختلافات في كفاءة التضخيم للجينات المستهدفة والجينات المرجعية [30 ، 31].

المقارن Cف طريقة تطبيع Cف قيمة الجين المستهدف للجينات المرجعية الداخلية قبل إجراء المقارنات بين العينات. أولا ، الفرق بين سيف القيم (& # x00394Cف) للجين المستهدف والمتوسط ​​الهندسي للجينات المرجعية المتعددة يتم حسابها لكل عينة ، ثم يتم حساب الفرق في & # x00394Cف (& # x00394 & # x00394Cف) يتم حسابها بين عينتين (على سبيل المثال ، السيطرة والمعالجة ، أو قبل وبعد العلاج). يتم حساب التغير في التعبير عن العينتين على أنه 2 - & # x00394 & # x00394Cq ، حيث 2 مشتق من 1 + الكفاءة ويفترض أن تكون الكفاءة 1 (أي 100٪ كفاءة) [28]. توصيتنا لاستخدام المقارن Cف الطريقة مدرجة في المربع 9.

المربع 9

من المهم التأكد من أن الجينات المرجعية والجينات المستهدفة لها كفاءة تضخيم مماثلة عند استخدام المقارن Cف طريقة وإلا ينبغي النظر في طريقة Pfaffl.

B. اختيار الجينات المرجعية

تم استخدام العديد من الجينات المرجعية التقليدية على نطاق واسع في تحليل qPCR. ذكرت مقالة مراجعة أن 33٪ و 32٪ من تحليل التعبير من 6 مجلات عالية التأثير مستخدمة نازعة هيدروجين غليسرالديهيد -3 فوسفات (جابده) و أكتين بيتا (ACTB) كجينات مرجعية على التوالي للأبحاث المنشورة عام 1999 [32]. ومع ذلك ، أشار الاستعراض نفسه إلى أن التعبير عن كليهما جابده و ACTB يختلف اختلافًا كبيرًا في ظل ظروف تجريبية مختلفة في مجموعة من الأنسجة [32]. جابده تم تحديده في الأصل على أنه وسيط في مسار تحلل السكر ومن المتوقع أن يكون موجودًا بثبات في جميع الخلايا ، وبالتالي تم اختياره كجين مرجعي. ومع ذلك ، فإن الأنشطة الأخرى جابده، بما في ذلك الوظائف في الالتقام الخلوي والتحكم الانتقالي وتضاعف الحمض النووي [33] ، لم يتم التعرف عليها حتى وقت لاحق [32].

تم استخدام جينات مرجعية مختلفة في دراسات تمارين مختلفة. ماهوني وآخرون. - [34] ذكرت ذلك & # x003b2-2- مكروغلوبولين (B2M) و ACTB كانت الجينات المرجعية الأكثر استقرارًا بعد 300 تقلص غريب الأطوار ، بينما B2M و جابده كانت الأكثر استقرارًا بعد 75 دقيقة من ركوب الدراجات المتقطع عالي الكثافة. في دراسة أخرى ، تم أخذ الخزعات العضلية قبل وبعد 30 دقيقة من تشغيل جهاز المشي بنسبة 70٪ من VO.2 ماكس، و RNA من 40 ألياف مفردة. جابده تم العثور عليه بشكل ثابت في جميع العينات [35]. وبالتالي ، عند استخدام الجينات المرجعية كضوابط داخلية لدراسة التمرين ، يجب تقييم استقرار كل جين مرجعي بعناية ، ولا يوجد جين & # x02018one-size-fits-all & # x02019 يمكن استخدامه في جميع الدراسات و مع جميع بروتوكولات التمرين.

من أجل تقليل تنوع الرقابة الداخلية ، يوصى باستخدام جينات متعددة للتطبيع [36 ، 37]. باستخدام عينات تم الحصول عليها من خطوط خلايا الورم الأرومي العصبي ، أظهر فاندزومبيلي وزملاؤه أن التطبيع باستخدام جين مرجعي واحد أدى إلى اختلافات بمقدار 3.0 أضعاف في 25٪ و 6.4 ضعفًا في 10٪ من الحالات التي تم تحليلها [36]. يمكن تحقيق تقييم الجينات المرجعية من خلال إجراء تحليل إحصائي على Cف قيمة أو استخدام البرامج المتاحة. تتوفر العديد من البرامج لتقييم الجينات المرجعية باستخدام مناهج تحليلية مختلفة ، مثل BestKeeper [38] و NormFinder [39] و GeNorm [36].

في مختبرنا ، لدينا ستة جينات مرجعية شائعة الاستخدام ، ACTB, بروتين رابط TATA (TBP), سيكلوفيلين, جابده, B2M، و 18S الرنا الريباسي (الجدول 4). هناك عدة أسباب لاختيار هذه الجينات المرجعية المرشحة. بادئ ذي بدء ، من المحتمل أن تكون هذه الجينات الستة جينات مرجعية يتم التعبير عنها بثبات ، وتستخدم على نطاق واسع في تحليل qPCR لعينات العضلات الهيكلية التي تم الحصول عليها في دراسات التمرينات البشرية [34 ، 35 ، 40]. ثانيًا ، ينتمون إلى فئات وظيفية مختلفة ، وبالتالي فمن غير المحتمل أن يتم تنظيمهم بشكل مشترك. ومع ذلك ، باستخدام المقارن Cف من الصعب تحديد الاختلافات الصغيرة في التعبير الجيني (أي أقل من ضعفين) ما لم يتم استخدام جينات مرجعية متعددة معبر عنها بثبات للتطبيع [36 ، 41].

الجدول 4

الجينالانضمام لا.الوظيفة (قاعدة بيانات التسلسل المرجعي NCBI [42])
ACTB (أكتين بيتا) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_001101.3"، "term_id": "168480144"، "term_text": "NM_001101.3" >> NM_001101.3يشفر هذا الجين واحدًا من ستة بروتينات أكتين مختلفة ، والتي تعد مكونًا رئيسيًا لجهاز مقلص وواحد من اثنين من الأكتين غير العضلي الهيكلي الخلوي.
TBP (بروتين رابط علبة تاتا) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_003194.4"، "term_id": "285026518"، "term_text": "NM_003194.4" >> NM_003194.4يشفر هذا الجين عامل نسخ عام يرتبط بشكل خاص بتسلسل DNA يسمى صندوق TATA ، ويساعد في وضع RNA polymerase II فوق موقع بدء النسخ للجين.
سيكلوفيلين (PPIA, بيبتيديل - بروبيل سي آي إس ترانس أيزوميراز أ) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_021130.4"، "term_id": "665821272"، "term_text": "NM_021130.4" >> NM_021130.4يقوم هذا الجين بتشفير البروتين الذي يحفز أزمرة رابطة الدول المستقلة من روابط الببتيد برولين إيميديك في قليل الببتيدات ويسرع طي البروتينات.
GAPDH (نازعة هيدروجين جلسيرالديهيد -3 فوسفات) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_001289746.1"، "term_id": "576583523"، "term_text": "NM_001289746.1" >> NM_001289746.1يشفر هذا الجين إنزيمًا رئيسيًا في مسار التحلل السكري ، والذي يحفز الفسفرة المؤكسدة القابلة للانعكاس لجليسرالديهيد -3 فوسفات في وجود الفوسفات غير العضوي والنيكوتيناميد الأدينين ثنائي النوكليوتيد (NAD).
B2M (& # x003b2-2- ميكروغلوبولين) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_004048.2"، "term_id": "37704380"، "term_text": "NM_004048.2" >> NM_004048.2يقوم هذا الجين بتشفير بروتين مصل بالاقتران مع سلسلة ثقيلة من الفئة الأولى من معقد التوافق النسيجي الرئيسي (MHC) على سطح جميع الخلايا المنواة تقريبًا.
18S rRNA (RNA, 18S الريبوسوم) <"type": "entrez-nucleotide"، "attrs": <"text": "NR_003286.2"، "term_id": "225637497"، "term_text": "NR_003286.2" >> NR_003286.2يمثل هذا الجين جزءًا من تكرار الحمض النووي الريبي (rDNA) الذي يشفر 18S rRNA.

التجربة 4

في دراستنا للتمرين البشري (انظر المواد والأساليب) ، تم أخذ عينات من العضلات من 9 مشاركين في حالة الراحة (خط الأساس) ، ثم بعد ذلك فورًا بعد (0 ساعة) و 3 ساعات (3 ساعات) الجلسة التدريبية النهائية لمدة 4 أسابيع تدخل التدريب. تم تجميد جميع عينات العضلات مباشرة بعد خزعة العضلات ، وتم استخراج الحمض النووي الريبي لجميع العينات (ن = 27) باستخدام RNeasy Plus Universal Mini Kit مع بروتوكول معدل (باستخدام 2-بروبانول) لجميع العينات التي حصلنا عليها أ260/أ280 نسبة أكبر من 1.9 ودرجة RQI أكبر من 7 (باستخدام نظام Experion الآلي الكهربائي). ثم أجرينا النسخ العكسي لتحويل الحمض النووي الريبي إلى (كدنا) في تشغيل واحد ، قبل إجراء تحليل qPCR. للعثور على جينات مرجعية معبر عنها بثبات في جميع العينات في جميع النقاط الزمنية ، اختبرنا ستة جينات مرجعية (ACTB, TBP, سيكلوفيلين, جابده, B2M، و 18 ثانية جدول الرنا الريباسي 5 والشكل 7). ثم استخدمنا RefFinder لتقييم استقرار هذه الجينات. RefFinder هي أداة قائمة على الويب ، قادرة على تشغيل أربع خوارزميات راسخة في وقت واحد (GeNorm [36] ، BestKeeper [38] ، NormFinder [39] و delta-CT المقارن [43]) ، قم بتعيين وزن مناسب لكل منها الجين الفردي ، وحساب المتوسط ​​الهندسي لأوزانهم للترتيب النهائي العام [44]. بناءً على الترتيب الشامل الموصى به من RefFlinder ، تم تصنيف الجينات المرشحة لدينا من الأكثر إلى الأقل استقرارًا B2M, TBP, 18S الرنا الريباسي, ACTB, جابده و سيكلوفيلين (الجدول 5).

جف قيم ردود الفعل الفردية باستخدام ACTB, TBP, سيكلوفيلين, جابده, B2M، و 18S الرنا الريباسي يتم تقديم الاشعال. جميع العينات مأخوذة من دراسة تمرين (ن = 9 مشاركين & # x000d7 3 نقاط زمنية = 27 عينة).

الجدول 5

ترتيب الترتيب (الأكثر استقرارًا إلى الأقل)
طريقة123456
دلتا سي تيTBPB2M18S الرنا الريباسيACTBجابدهسيكلوفيلين
أفضل حارسB2MTBP18S الرنا الريباسيACTBجابدهسيكلوفيلين
نورمفايندرTBPB2M18S الرنا الريباسيACTBجابدهسيكلوفيلين
جينورمB2M / 18S rRNATBPACTBجابدهسيكلوفيلين
الترتيب الشامل الموصى بهB2MTBP18S الرنا الريباسيACTBجابدهسيكلوفيلين

لتوضيح كيف يمكن للمرء أن يختار الجينات المرجعية ، نختار محفز PPARG 1 alpha (PGC-1 & # x003b1) كمثال لتحليل التعبير الجيني. PGC-1 & # x003b1 هو منشط نسخي غني بالعضلات الهيكلية. لقد ثبت أن التمرينات قادرة على الزيادة PGC-1 & # x003b1 محتوى mRNA في البشر [45]. كانت كفاءة التضخيم لجميع الجينات المرجعية الستة المرشحة مماثلة للجين المستهدف لدينا ، PGC-1 & # x003b1 (الجدول 6). استخدمنا الوسط الهندسي لأعلى ثلاث جينات مرتبة بواسطة RefFinder (TBP, B2M، و 18S الرنا الريباسي) لتطبيع البيانات اللاحقة. تم سرد توصياتنا لاختيار الجينات المرجعية في المربع 10.

الجدول 6

الجينالانضمام لا.مواد أولية (أمامية وخلفية)حجم أمبليكون (بي بي)بداية الموقف (بي بي)كفاءة (٪)مصدر
TBP (بروتين رابط علبة تاتا) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_003194.4"، "term_id": "285026518"، "term_text": "NM_003194.4" >> NM_003194.4 F: كاجتجاكككاجكاجكاتكاكت
R: أجككاجككتجاجكجتا
20512199[46]
سيكلوفيلين (PPIA, بيبتيديل - بروبيل سي آي إس ترانس أيزوميراز أ) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_021130.4"، "term_id": "665821272"، "term_text": "NM_021130.4" >> NM_021130.4 F: جتكاككككاككجتجتكتتك
R: TTTCTGCTGTCTTTGGGACCTTG
10093100[47]
B2M (& # x003b2-2- ميكروغلوبولين) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_004048.2"، "term_id": "37704380"، "term_text": "NM_004048.2" >> NM_004048.2 F: TGCTGTCTCCATGTTTGATGTATCT
R: تكتكتجكتكككاككتكتاجت
8658998[36]
ACTB (أكتين بيتا) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_001101.3"، "term_id": "168480144"، "term_text": "NM_001101.3" >> NM_001101.3 F: جاجكاكاجككتكجككتت
R: TCATCATCCATGGTGAGCTGGC
7026107صممه المؤلفون
18S rRNA (RNA, 18S الريبوسوم 5) <"type": "entrez-nucleotide"، "attrs": <"text": "NR_003286.2"، "term_id": "225637497"، "term_text": "NR_003286.2" >> NR_003286.2 F: CTTAGGGACAAGTGCG
R: GGACATCTAAGGGCATCACA
71144399[48]
GAPDH (نازعة هيدروجين جلسيرالديهيد -3 فوسفات) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_001289746.1"، "term_id": "576583523"، "term_text": "NM_001289746.1" >> NM_001289746.1 F: أتككاتكاككاتكتككا
R: تججاكتككاكجاكجتاكتا
82388106[49]
PGC-1 & # x003b1 (PPARG coactivator 1 alpha) <"type": "entrez-nucleotide"، "attrs": <"text": "NM_013261.3"، "term_id": "116284374"، "term_text": "NM_013261.3" >> NM_013261.3 F: كاجككتكتتجكككاجاتكت
R: TCACTGCACCACTTGAGTCCAC
101199104[50]

المربع 10

يوصى باختبار جينات مرجعية متعددة [36 ، 37] ، ويجب تقييم استقرار كل جين قبل اختيار الجينات المرجعية المناسبة لدراسة معينة. نوصي باستخدام RefFinder لتقييم استقرار الجينات المرجعية ، حيث إنه يدير أربع خوارزميات راسخة في وقت واحد. بخلاف استقرار الجين المرجعي ، يجب أن تكون كفاءة تضخيم الجينات المرجعية مماثلة للجينات المستهدفة.

جيم تطبيع التعبير الجيني عن طريق القياس الكمي (كدنا)

يعد العثور على جينات مرجعية مستقرة تحديًا عند إجراء qPCR ، وكان الباحثون يبحثون عن طرق بديلة مثل القياس الكمي لـ cDNA. كواشف Quant-iT & # x02122 OliGreen ssDNA عبارة عن صبغة حمض نووي فلورسنت لقياس cDNA ، وقد تم استخدامه في العديد من الأوراق المنشورة بما في ذلك الدراسات التي تبحث في التعبير الجيني في العضلات الهيكلية البشرية ردًا على التمرين [51 & # x0201353]. هناك مشكلة محتملة في استخدام صبغة OliGreen لتحديد محتوى cDNA وهي أن الصبغة حساسة أيضًا للحمض النووي الريبي ، كما هو مذكور في دليل المستخدم & # x0201cلا يُظهر كاشف OliGreen تحسينًا مضانًا عندما يرتبط بـ RNA& # x0201d [54].

تجربة 5

لاختبار خصوصية وصلاحية استخدام صبغة OliGreen لتأهيل محتوى cDNA ، قمنا بتوليف cDNA من أربعة مقادير مختلفة (0 ، 0.25 ، 0.5 ، 1 & # x003bcg) من RNA تم الحصول عليها من التجربة 1 (& # x02018Good Practice & # x0201d، n = 4 لكل مدخلات RNA). قمنا أيضًا بتحميل 1 & # x003bcg RNA في تفاعل التحكم & # x02013RT ، والذي لا يحتوي على cDNA (n = 4). استخدمنا iScript & # x02122 النسخ العكسي Supermix (Bio-Rad) لتوليف cDNA. يحتوي إنزيم النسخ العكسي للإنزيم في هذه المجموعة على نشاط RNase H + الذي يحط من خيط RNA في هجينة RNA-DNA بعد تخليق cDNA. تم بعد ذلك قياس محتوى (كدنا) في كل عينة باستخدام صبغة OliGreen (الشكل 8 أ). تمشيا مع البحث السابق [51] ، أظهرت عينات (كدنا) المركبة من كميات مختلفة من الحمض النووي الريبي ارتباطًا إيجابيًا قويًا لتركيز (كدنا) المقاس مقابل إدخال الحمض النووي الريبي (ص = 0.9947 ، ص& # x0003c 0.0001) (الشكل 8 ب). ومع ذلك ، فإن تفاعل التحكم -RT ، الذي يحتوي على 1 & # x003bcg RNA فقط ولكن لا يوجد cDNA ، أظهر قراءة أعلى من cDNA المركب من 0.5 & # x003bcg RNA. أكدت هذه النتيجة أن صبغة OliGreen لا تقيس ssDNA على وجه التحديد ، ولكنها تقيس الحمض النووي الريبي أيضًا. قد يتسبب هذا في وجود محتوى مرتفع كاذب (كدنا) في الفحص إذا لم يتم تدهور الحمض النووي الريبي بشكل صحيح. يتم سرد توصياتنا لتطبيع التعبير الجيني عبر القياس الكمي (كدنا) في المربع 11.

A: Determination of cDNA amount in reactions with different RNA input. Different amounts of RNA were used to synthesise cDNA (n = 4 for each RNA input), and the relative amount of cDNA in each reaction was measured using OliGreen dye. Values are presented as mean ± SD. B: Correlation between RNA input and average relative amount of cDNA measured.

Box 11

In order to obtain an accurate and specific measurement of cDNA from the Oligreen dye, RNA in the RNA-DNA hybrids needs to be degraded before measurement. This can be achieved by using a reverse transcriptase enzyme with RNase H + activity ( Fig 8 ), or including an RNase degradation step after cDNA synthesis [51].

D. Effect of normalisation methods on the results

Experiment 6

To investigate how normalisation might alter the outcome, we measured the exercise-induced expression of PGC-1α mRNA in the samples from a human exercise study (as described in Experiment 4) and analysed the same set of data in three ways. We performed normalisation using three of the most stable reference genes (TBP, B2M، و 18S الرنا الريباسي), based on the reference gene evaluation ( Table 5 ). In comparison, we also used a single reference gene, Cyclophilin, which was the lowest ranked reference gene. Lastly, we analysed the data using the cDNA content measured by Quant-iT ™ OliGreen ssDNA Reagent. We saw a significant difference in gene expression at 3 hours after exercise using all three normalisation options (P < 0.01, Fig 9 ). These exercise-induced fold changes in PGC-1α expression are consistent with the existing literature [40, 45].

Muscle samples were taken at rest (Baseline, Week 0) and immediately post-exercise (0 h), and 3 h post-exercise. Data were analysed using 3 different normalisation methods. Values are fold change ± SD.

There were no significant differences between the fold changes in PGC-1α mRNA content when using different methods of normalisation however, the fold changes were more similar when using three reference genes and cDNA content for normalisation, rather than using one reference gene. The increase of PGC-1α was 3.4 ± 2.0 fold when three reference genes were used for normalisation. When a single reference gene (Cyclophilin) was used for normalisation, the increase in gene expression was 5.1 ± 2.4 fold (P = 0.08 compared to 3 reference genes). When cDNA content was used for normalisation, the increase of gene expression was 3.2 ± 1.9 fold (ص = 0.51 compared to 3 reference genes, ص = 0.09 compared to 1 reference gene). In certain experimental settings, especially when examining small changes in mRNA level, these different results could lead to different conclusions. This may also help to explain the inter-study variability for exercise-induced changes in mRNA content. As previously suggested, use of a single reference gene is considered ‘not acceptable’ unless its stability has been clearly demonstrated in the same study [1]. Our recommendations for normalising gene expression via reference genes are listed in Box 12.

Box 12

We recommend testing four or more candidate reference genes for each study, and selecting the ones that are stably expressed for data normalisation. In our research laboratory, we chose to use two to three most stable reference genes based on evaluation software for an individual study [45, 55].


DNA provirus hypothesis

In the mid-20th century there were many advances in molecular biology, including the description of DNA in 1953 by American geneticist and biophysicist James D. Watson and British biophysicists Francis Crick and Maurice Wilkins. By the 1960s it was understood that sarcomas are caused by a mutation that results in uncontrolled cell division. It was also evident that RSV was inherited during the division of cancerous cells. This inheritance occurred in a manner agreeing with the Mendelian laws of genetic inheritance—laws that heretofore had been understood to apply only to DNA molecules (ارى the articles genetics and heredity).

Scientists hypothesized that, in order for such viral inheritance to occur, a virus would need to transcribe its RNA genome into DNA and then insert this DNA into the host cell genome. Once incorporated into the host genome, the virus would be transcribed as though it were another gene and could produce more RNA virus from its DNA. This hypothesis, called the “DNA provirus hypothesis,” was developed in the late 1950s by American virologist Howard Martin Temin, when he was a postdoctoral fellow in the laboratory of Italian virologist Renato Dulbecco at the California Institute of Technology. Temin’s hypothesis was formally proposed in 1964. The provirus hypothesis came about when experiments demonstrated that an antibiotic called actinomycin D, which is capable of inhibiting DNA and RNA synthesis, inhibited the reproduction of RSV. However, the concept of an RNA molecule’s turning itself into DNA drew very few supporters.


شاهد الفيديو: تكاثر الفيروسات 5 (يوليو 2022).


تعليقات:

  1. Zolorr

    توقف في منتدى وشاهد هذا الموضوع. هل تسمح لي بالمساعدة؟

  2. Dougal

    مدونتك هي المفضلة لدي

  3. Conradin

    عذرا لذلك أنا أتدخل ... أنا أفهم هذا السؤال. فمن الممكن للمناقشة.

  4. Endre

    يجب أن تقول ذلك - الباطل.

  5. Ho

    نعم حقا. وقد واجهته. يمكننا التواصل حول هذا الموضوع.

  6. Lambrecht

    السؤال الترفيهي للغاية

  7. Pryderi

    الجواب المهم والأصول على النحو الواجب

  8. Kajir

    اليوم قرأت الكثير عن هذه القضية.

  9. Willem

    أنا أفهم هذا السؤال. سنناقش.



اكتب رسالة