معلومة

ما المقصود بالقمع المترجم بإطار قراءة مفتوح منبع؟

ما المقصود بالقمع المترجم بإطار قراءة مفتوح منبع؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

يحتوي تقرير NCBI عن جين هنتنغتين البشري على البيان التالي:

"يحتوي هذا الجين على إطار قراءة مفتوح منبع في UTR 5 'الذي يمنع التعبير عن منتج جين هنتنغتين من خلال القمع الترجمي."

لكن لم تعطه إشارة محددة. يمكن لأي شخص أن يشرح ما يعنيه هذا.


ملخص

يشير البيان إلى الترجمة الصغيرة ولكن المهمة لإطارات القراءة المفتوحة القصيرة (ORFs) لـ Huntingtin mRNA ، 5 'إلى إطار القراءة المفتوح الرئيسي الذي يشفر المنتج الوظيفي الكبير (3144 من الأحماض الأمينية) لـ mRNA (والجين). تم الإبلاغ عن أن ترجمة ORFs القصيرة هذه تقلل (أي تمنع) الترجمة من ORF الرئيسي. من المفهوم ضمنيًا أن هذه آلية لتنظيم التعبير عن الجين ، وكما يحدث على الرنا المرسال في السيتوبلازم ، فهي مثال على "التنظيم الانتقالي" - على وجه التحديد التثبيط. الآلية الدقيقة لهذا التنظيم - على الرغم من أنها ليست فريدة من نوعها لهذا الرنا المرسال - غير معروفة على ما يبدو.

ترجمة ORFs في حقيقيات النوى مرنا

معظم جزيئات الرنا المرسال حقيقية النواة أحادية النواة وظيفيًا - أي أنها تشفر بروتينًا واحدًا فقط - على عكس الرنا المرسال البكتيري. يتضمن بدء تخليق البروتين اختيار كودون بدء (عادةً AUG) بواسطة مجموعة من البادئ- tRNA والوحدة الفرعية للريبوسوم الصغير ، ولكن على عكس بدائيات النوى ، تتضمن الآلية الموجودة في حقيقيات النوى المسح على طول الرنا المرسال من الطرف الخامس. في معظم الحالات ، يكون كودون البدء لمنتج البروتين هو أول AUG ، لكن العدد الكبير من الاستثناءات يشير إلى تأثير سياق التسلسل أو البنية الثانوية لـ mRNA.

في السنوات الأخيرة ، تراكمت الأدلة على أنه في الحالات التي لا يكون فيها AUG الأول هو منتج البروتين الرئيسي ، غالبًا ما تحدث كمية صغيرة من الترجمة من 5 'ORFs المنبع.

تمثيل تخطيطي لـ mRNA مع ORF المنبع (الأزرق مع كودون البدء يمثل كمثلث مفتوح) و ORF الرئيسي (أسود مع كودون البدء كمثلث مغلق.)

الدور التنظيمي لـ ORFs المنبع

جونستون وآخرون. قام (2016) بمراجعة مجموعة كبيرة من الأدلة التي تشير إلى أن ORFs المنبع هي مثبطات انتقالية في حقيقيات النوى. تم تحديد ذلك بشكل عام عن طريق قياس مدى ترجمة ORF الرئيسي بعد التلاعب أو إزالة ORFs المنبع. لا يُعرف الكثير عن الآلية الفعلية لمثل هذا التنظيم ، والتي قد تختلف من حالة إلى أخرى ، وبالتأكيد فإن الورقة البحثية عن هنتنغتين لم تقدم سوى إمكانيات مضاربة. وتشمل هذه:

  • ربط منتجات الببتيد الصغيرة من ORFs المنبع إلى AUG من ORF الرئيسي
  • الإيقاف المؤقت لمركب البدء الريبوسومي عند المنبع ORFs يعوق تقدم الآخر إلى AUG من ORF الرئيسي
  • تغيير الهيكل الثانوي للـ mRNA عن طريق ربط معقد البدء الريبوسومي عند المنبع ORFs مما يزيد من صعوبة خطوة البدء التي يتم فيها "ذوبان" الطرف الخامس.

يبدو أيضًا أن مدى ترجمة ORFs المنبع - وبالتالي مدى القمع - يمكن تنظيمه بحد ذاته بواسطة آليات مثل فسفرة عامل البدء eIF2.


ما المقصود بالقمع المترجم بإطار قراءة مفتوح منبع؟ - مادة الاحياء

تحليل تنظيم ام اس ال -2 mRNA by Sex lethal (SXL) ، وهو أمر بالغ الأهمية لتعويض الجرعة في ذبابة الفاكهة، كشف النقاب عن وضع للتحكم الترجمي يعتمد على عناصر المنطقة المشتركة 5 غير المترجمة ، وإطارات القراءة المفتوحة المنبثقة (uORFs) ، ومواقع التفاعل لبروتينات ربط الحمض النووي الريبي. نظهر أن ربط SXL المصب لـ uORF القصير يفرض تأثيرًا سلبيًا قويًا على ترجمة إطار القراءة الرئيسية. تتضمن الآلية الأساسية زيادة الشروع في مسح الريبوسومات في uORF وزيادة عائقها أمام الترجمة النهائية. تكشف تحليلاتنا أن SXL يمارس تأثيره في التحكم في البدء ، وليس الاستطالة أو الإنهاء ، في uORF. من خلال التحقيق في عمومية الآلية الأساسية ، نظهر أن الوحدة التنظيمية التي نحددها تجريبيًا الوظائف في سياق غير متجانس ، ونحدد الطبيعة ذبابة الفاكهة mRNAs التي يتم تنظيمها عبر هذه الوحدة. نقترح أن uORFs التي ينظمها البروتين تشكل مبدأ منهجيًا لتنظيم تخليق البروتين.

ملخص رسومي

يسلط الضوء

ذبابة الفاكهة يتعاون بروتين SXL مع uORF للتنظيم ام اس ال -2 ترجمة mRNA ، تستهدف اللوائح التي تتم بوساطة SXL بدء الترجمة ، وليس الاستطالة أو الإنهاء ام اس ال -2 الترجمة ► قد تحدد uORFs المنظمة بالبروتين آلية عامة للتحكم في الترجمة


ما المقصود بالقمع المترجم بإطار قراءة مفتوح منبع؟ - مادة الاحياء

س- أدينوسيل ميثيونين ديكاربوكسيلاز (AdoMetDC) هو إنزيم رئيسي في التخليق الحيوي لعديد الأمين. نظهر أن نشاط AdoMetDC للنبات يخضع للتحكم اللاحق للنسخ بواسطة مادة البولي أمينات. إطار القراءة المفتوح الصغير والمحفوظ للغاية (uORF) في قائد AdoMetDC mRNA 5 مسؤول عن القمع الترجمي لمراسل β-glucuronidase المصب في نباتات التبغ المعدلة وراثيًا. أدى التخلص من uORF الصغير من AdoMetDC (كدنا) إلى زيادة الكفاءة الترجمية النسبية لبروزيم AdoMetDC في النباتات المحورة جينيا. أدى النشاط المتزايد الناتج من AdoMetDC إلى تعطيل مستويات البوليامين مع استنفاد البوتريسين ، وانخفاض مستويات الحيوانات المنوية ، وزيادة أكثر من 400 ضعف في مستوى منزوعة الكربوكسيل. س- أدينوسيل ميثيونين. ارتبطت هذه التغييرات بنمو حاد وعيوب في النمو. المستوى العالي من منزوع الكربوكسيل سلم يترافق - أدينوسيل ميثيونين مع أي تغيير في محتوى 5′-ميثيل سيتوزين في الحمض النووي الجيني و س- كانت مستويات الأدينوسيل ميثيونين طبيعية إلى حد ما ، مما يشير إلى وجود نظام عالي الكفاءة لصيانةس- مستويات الأدينوسيل ميثيونين في النباتات. يوضح هذا العمل أن التحكم الترجمي بوساطة uORF في AdoMetDC ضروري لاستتباب البولي أمينات والنمو الطبيعي والتطور.


ما المقصود بالقمع المترجم بإطار قراءة مفتوح منبع؟ - مادة الاحياء

الإفراط في التعبير عن HER-2 (جديد, erb ينتج عن مستقبل B-2) التحول الخلوي ويرتبط بمجموعة متنوعة من السرطانات البشرية. تساهم الآليات المتعددة ، بما في ذلك تضخيم الجينات وضوابط النسخ ، وما بعد النسخ ، والترجمة في تنظيم تعبير HER-2. أحد مكونات هذه الآليات التنظيمية هو إطار قراءة مفتوح قصير (uORF) في HER-2 mRNA الذي يقمع الترجمة النهائية في مجموعة متنوعة من أنواع الخلايا. هنا نستكشف الآلية التي من خلالها يمارس uORF تأثيره المثبط.

كما يُحكم عليه من خلال مقارنات وفرة البروتين و mRNA وبواسطة تحليلات التوزيع المتعدد ، فإن uORF يقمع ترجمة سيسترون HER-2 أو جين مراسل غير متجانسة. على الرغم من حفظه بين أنواع الثدييات ، فإن تسلسل الببتيد الخاص بـ uORF غير مطلوب لهذا التأثير المثبط. بدلاً من ذلك ، فإن غالبية الريبوسومات التي يتم تحميلها على HER-2 mRNA تقوم على الأرجح بترجمة uORF ومن ثم تكون غير قادرة على إعادة التشغيل في كودون AUG في اتجاه المصب ، ويرجع ذلك جزئيًا إلى التباعد الزمني القصير. تحصل أقلية من الريبوسومات على إمكانية الوصول إلى كود بدء HER-2 إما عن طريق المسح المتسرب عبر كودون AUG المنبع أو عن طريق إعادة البدء بعد ترجمة uORF على الرغم من المنطقة القصيرة بين الإلكترونات. تشير هذه النتائج إلى أن HER-2 uORF يتحكم في تخليق هذا البروتين الورمي عن طريق الحد من وصول الريبوسوم إلى مواقع البدء في المصب.


ينظم uORF المحفوظ تطوريًا PGC1α والتمثيل الغذائي التأكسدي في الفئران والذباب والتونة ذات الزعانف الزرقاء

يتم التحكم في وفرة الميتوكوندريا ووظيفتها بإحكام أثناء التكيف الأيضي ، ولكنها غير منظمة في الحالات المرضية مثل مرض السكري ، والتنكس العصبي ، والسرطان ، وأمراض الكلى. نوضح هنا أن ترجمة PGC1α ، وهو حاكم رئيسي للتكوين الحيوي للميتوكوندريا والتمثيل الغذائي التأكسدي ، يتم تنظيمها سلبًا بواسطة إطار قراءة مفتوح المنبع (uORF) في المنطقة غير المترجمة 5 'من جينها (PPARGC1A). نجد أن القمع الترجمي بوساطة uORF هو سمة من سمات أخصائي تقويم العظام PPARGC1A من الإنسان إلى الطيران. اللافت للنظر ، في حين أن UORFs المثبطة المتعددة موجودة على نطاق واسع في تقويم العظام PPARGC1A ، فهي غائبة تمامًا في التونة الأطلسية ذات الزعانف الزرقاء ، وهو حيوان يحتوي على نسبة عالية من الميتوكوندريا. في الفئران ، تؤدي الطفرة المهندسة التي تعطل PPARGC1A uORF إلى زيادة مستويات البروتين PGC1α والتمثيل الغذائي التأكسدي ، وتوفر الحماية من إصابة الكلى الحادة. تحدد هذه الدراسات عنصرًا تنظيميًا انتقاليًا يتحكم في التمثيل الغذائي التأكسدي وتسليط الضوء على مساهمته المحتملة في تطور وظيفة الميتوكوندريا العضوية.

الكلمات الدالة: 5 'منطقة غير مترجمة PGC1α تطور التونة ذات الزعانف الزرقاء.


المواد والأساليب

سلالات الخميرة والبلازميدات

تم تحويل خلايا الخميرة على النحو الموصوف سابقًا [56] ، وتم اختيار المحولات على الوسط المناسب الذي يفتقر إلى العناصر الغذائية المقابلة للواسم / الواسمات المساعدة. يتم توفير القائمة التفصيلية للسلالات والبلازميدات المستخدمة في الدراسة في ملف إضافي 2: الجدولين S1 و S2 ، على التوالي. ال upf1Δ سلالة سبق وصفها [24]. بلازميد ريال. لا. 1-8 موصوفة في [4] ، plasmid sr. لا. 9-10 موصوفة في [21] ، والبلازميد sr. لا. 11 موصوفة في [26].

المقايسات البيوكيميائية

تم إجراء اختبار ثنائي لوسيفيراز كما هو موضح سابقًا [4 ، 20] مع بعض التعديلات الطفيفة. نمت خلايا الخميرة من النوع البري / الطافرة التي لها إما مراسل تحكم (R AUG FF AUG) أو مراسل اختبار (R AUG FF XXX) (الشكل 1 أ) طوال الليل إلى التشبع. ثم تم تخفيف الخلايا للوصول إلى OD المطلوب600 0.6-0.8 في 16 ساعة عند درجة الحرارة المختبرة (على سبيل المثال ، 20 درجة مئوية ، 30 درجة مئوية). لحساب نشاط لوسيفيراز ، تمت إضافة 2 ميكرولتر من الثقافة إلى 50 ميكرولتر من 1 × مخزن تحلل سلبي (Promega # E1941) والذي تم اقتطاعه في لوحة قارئ (Corning # CLS3912) ، متبوعًا بالتحلل في درجة حرارة الغرفة لمدة 50 دقيقة. تم قياس نشاط luciferase باستخدام قارئ الصفيحة الدقيقة Turner Modulus عند 24 درجة مئوية. باختصار ، 50 ميكرولتر من كاشف F-Luc (15 ملي مولار تريس الأس الهيدروجيني 8.0 ، 25 ملي جلايسيل جليسين ، 4 مم EGTA ، 15 ملي MgSO4تمت إضافة 1 ملي مولار DTT و 2 ملي مولار من ATP و 0.1 ملي مولار CoA و 75 ميكرومتر من لوسيفيرين) إلى كل بئر. تم قياس النشاط بوقت تأخير (المدة بين حقن الكاشف وأخذ القياس) 2 ثانية ووقت التكامل (مدة القياس لكل بئر) 1 ثانية. تم قياس نشاط R-Luc في نفس البئر على الفور بإضافة 50 ميكرولتر من كاشف R-Luc (0.22 مولار حامض الستريك-سترات الصوديوم pH 5 ، 1.1 مولار كلوريد الصوديوم ، 2.2 ملي مولار Na2EDTA ، 1.3 ملي مولار3، 0.44 مجم / مل BSA ، 1.43 ميكرومتر من coelenterazine) مع نفس إعدادات القياس مثل F-Luc. تم حساب النشاط النسبي لوسيفيراز اليراع (F-Luc) عن طريق التطبيع مع نشاط Renilla luciferase (R-Luc) لإنتاج قيم FF AUG / R AUG (AUG) أو FF UUG / R AUG (UUG). لحساب النشاط الطبيعي لـ firefly luciferase بدءًا من UUG ككودون بدء ، تم تطبيع قيمة FF UUG / R AUG إلى FF AUG / R AUG لنسبة UUG / AUG. تم حساب التعبير الطبيعي عن الكودونات الأخرى القريبة (على سبيل المثال ، ACG ، AUU) بطريقة مماثلة.

تم إجراء فحوصات نشاط β-Galactosidase في مقتطفات الخلية الكاملة (WCEs) كما هو موضح سابقًا [57]. لفحص تعبير eIF1 (المشفر بواسطة SUI1) من خلال تحليل اللطخة الغربية ، تم إجراء WCEs في ظل ظروف تغيير طبيعة كما هو موضح سابقًا [58] من أربعة مكررات بيولوجية (محولات مستقلة). تم إجراء تحليل اللطخة المناعية [59] باستخدام الأجسام المضادة ضد eIF1 [60] و Ded1 (هدية طيبة من Tien-Hsien Chang). تم إجراء مكررين تقنيين باستخدام نفس المستخلصات ، وتم تحميل كميات مختلفة من كل مستخلص مرتين في مسارين متتاليين. تم استخدام اللمعان الكيميائي المحسن (Amersham # RPN2106) للكشف عن المجمعات المناعية باستخدام مصور ProteinSim simple (أنظمة FluorChem # FM0261) ، وتم قياس شدة الإشارة بواسطة قياس الكثافة باستخدام Adobe Photoshop بعد انعكاس الصورة كما هو موصوف [61].

التنميط الريبوسوم

ثقافة الخلية والتحلل

BY4741 خلايا تحتوي على بلازميد pR AUG FF UUG (مراسل ثنائي لوسيفيراز مع R-Luc (AUG) -F-Luc (UUG) في URA3 تم استخدام المتجه (انظر الملف الإضافي 2: الجدول S2) لتشكيل الريبوسوم ، والذي تم إجراؤه كما هو موصوف [8 ، 19 ، 30 ، 62] مع بعض التعديلات. سبعمائة وخمسون مليلترًا من خلايا الخميرة في مرحلة السجل (OD600 0.6-0.8) نمت في وسط اصطناعي كامل يفتقر إلى اليوراسيل (SC-Ura) عند 20 درجة مئوية ، 30 درجة مئوية ، أو 37 درجة مئوية لمدة 16 ساعة تم حصادها بسرعة (1 دقيقة) عن طريق الترشيح الفراغي في درجة حرارة الغرفة و المفاجئة- مجمدة في نيتروجين سائل. لم تتم إضافة أي هكسيميد حلقي إلى الوسائط قبل الحصاد لتجنب الآثار التي يسببها سيكلوهكسيميد [31،32،33،34]. تبع ذلك إضافة محلول تحلل الجليد البارد (20 ملي تريس [درجة الحموضة 8.0] ، 140 ملي مول كلوريد ، 1.5 ملي مول كلوريد2، 1٪ تريتون ، 500 ميكروغرام / مل سيكلوهيكسيميد). كان تركيز سيكلوهكسيميد في محلول التحلل هذا خمسة أضعاف التركيز المستخدم أصلاً في تجارب تحديد سمات الريبوسوم [8] لتقليل استطالة الترجمة المستمرة أثناء التحلل والمعالجة. تم فصل الكريات المجمدة في المخزن المؤقت للتحلل في مطحنة مجمدة (مطحنة التجميد / Mill® Dual Chamber Cryogenic Grinder ، # 6870 ، مع إعدادات 15 دورة ، عند 15 هرتز ، 5 دقائق قبل التبريد ، 1 دقيقة تشغيل متبوعًا بدقيقتين تبريد). تم نقل المحللة المجمدة إلى أنبوب مخروطي سعة 50 مل وتم إذابتها على الجليد مع التقليب المتكرر. تم طرد محلول الخلية عند 3000 دورة في الدقيقة (Eppendorf # 5810R) ، عند 4 درجات مئوية لمدة 5 دقائق ، وتم جمع المادة الطافية وطردها عند 13000 دورة في الدقيقة (

18000 RCF) في جهاز طرد مركزي أعلى منضدة (Eppendorf # 5417R) عند 4 درجات مئوية لمدة 10 دقائق. تم جمع المادة الطافية النهائية ، و OD260 تم قياسه. قسامات من المحللة تحتوي على 30 OD260 تم تخزين الوحدات عند -80 درجة مئوية حتى استخدامها.

عزل آثار أقدام الريبوسوم 80S لتسلسل إعداد المكتبة

قسامة من المحللة تحتوي على 30 OD260 تمت إذابة الوحدات على الجليد ومعالجتها بـ 500 وحدة من RNAse I (Ambion ™ # AM2294) - لمدة 60 دقيقة عند 26 درجة مئوية في خلاط حراري عند 700 دورة في الدقيقة. تمت إضافة خمسة ميكرولتر من مثبط SUPERase-In RNAse (Ambion ™ # AM2694) إلى التفاعل ، والذي تم استخدامه بعد ذلك لعزل 80S monosomes كما تم وصفه سابقًا [30]. باختصار ، لعزل 80S أحادي ، تم تحميل التفاعل على تدرج سكروز بنسبة 10-50٪ (وزن / حجم) مصنوع في محلول منظم ، متبوعًا بالطرد المركزي لمدة 3 ساعات عند 40.000 دورة في الدقيقة في دوار SW 41 Ti. تم فصل الكسور على نظام تجزئة متدرج الكثافة (براندل) باستخدام محلول سكروز 60٪ (مصنوع في محلول تحلل) لضخ التدرجات. تم جمع الكسور المقابلة لـ 80S ، وتمت تنقية شظايا mRNA المحمية بالريبوسوم (RPFs) باستخدام SDS / حمض الفينول الساخن والكلوروفورم.

عزل إجمالي مرنا لإعداد مكتبة RNA-seq

تم عزل إجمالي الحمض النووي الريبي من المحللة باستخدام miRNeasy Mini Kit (Qiagen # 217004) باتباع بروتوكول الشركة المصنعة. تم إجراء التجزئة العشوائية عن طريق إضافة كاشف التجزئة (Ambion # AM8740) والحضانة عند 70 درجة مئوية لمدة 8 دقائق ، متبوعة بإضافة محلول التوقف (من نفس المجموعة).

بناء مكتبة التسلسل

تم حل كل من الأجزاء المحمية من الريبوسوم (RPFs) وإجمالي mRNA المجزأ عن طريق الرحلان الكهربي على هلام TBE-Urea بنسبة 15 ٪ (Novex # EC68852BOX). بعد اختيار الحجم ، تم استخلاص الهلام من الحمض النووي الريبي وتم نزع الفسفرة باستخدام عديد النوكليوتيد كيناز (NEB # M0201S). تم ربط رابط استنساخ ميرنا عالمي (NEB # S1315S) بنهايات 3′ من الحمض النووي الريبي باستخدام T4 RNA Ligase 2 (NEB # M0242 L) في وجود PEG 8000 (2.5٪ w / v) و DMSO و SUPERase- في 37 درجة مئوية لمدة 2.5 ساعة. تم حل المنتجات المربوطة عن طريق الرحلان الكهربي على هلام TBE-Urea بنسبة 15٪ وتم إزالة الأجزاء ذات الحجم المناسب من الجل. تعرض الحمض النووي الريبي المرتبط بالرابط المسترجع من RPFs مباشرة للنسخ العكسي ، بينما تم استخدام ذلك المستخرج من عينات الحمض النووي الريبي الكلية المجزأة كمدخل لتفاعل Ribozero (مجموعة إزالة الرنا الريباسي الذهبية من Illumina Ribo-Zero Gold - الخميرة) لإزالة الحمض النووي الريبي ، ثم تعرض لاحقًا لعكس النسخ. للنسخ العكسي ، تم خلط 10 ميكرولتر من الحمض النووي الريبي (المذاب في 10 ملي مولار من درجة الحموضة 8.0) من التفاعل السابق مع 2 ميكرولتر من 1.25 ميكرومتر من التمهيدي للنسخ العكسي [5 ′ - (Phos) AGATCGGAAGAGCGTCGTGTAGGGAAGCTAGTGTAGATCTCGTAGTGTCGC (SpCGTGTC) عند 80 درجة مئوية لمدة 2 دقيقة وحضنت على الجليد. تبع ذلك إضافة SuperScript ™ III Reverse Transcriptase (# AM2694) و dNTPs و DTT و Superase-In وحضانة عند 48 درجة مئوية لمدة 30 دقيقة. تمت إزالة قالب الحمض النووي الريبي بإضافة 2.2 ميكرولتر من 1 N هيدروكسيد الصوديوم متبوعًا بحضانة عند 98 درجة مئوية لمدة 20 دقيقة. تم حل التفاعل على هلام 15٪ TBE-Urea ، وتم استخلاص cDNA من الجل. تم إجراء التعميم باستخدام CircLigase (Epicenter # CL4111K) عن طريق خلط 15 ميكرولتر من cDNA (مذاب في 10 ملي مولار من درجة الحموضة 8.0) مع 2 ميكرولتر من 10 × محلول CircLigase ، 1 ميكرولتر من 1 ملي ATP ، 1 ميكرولتر من 50 ملي MnCl2، و 1 ميكرولتر من CircLigase. تم تحضين التفاعل عند 60 درجة مئوية لمدة ساعة واحدة ، متبوعًا بتعطيل الحرارة عند 80 درجة مئوية لمدة 10 دقائق.

تم استخدام المنتجات الدائرية كقوالب لتضخيم PCR لعينة RNA الإجمالية ، أو تعرضت لأول مرة للتهجين الطرحي لإزالة المتواليات المشتقة من rRNA في حالة مكتبات RPF. بالنسبة للأخير ، تم خلط تفاعل التدوير مع مجمع طرح من أليغنوكليوتيدات المعالجة حيوياً [62] في وجود 2 × SSC (# AM9763) ، تم تغيير خصائصها عند 100 درجة مئوية لمدة 90 ثانية ، متبوعة بالتلدين عند 37 درجة مئوية. تم خلط التفاعل بعد ذلك مع Dynabeads وحضنت عند 37 درجة مئوية في خلاط حراري عند 1000 دورة في الدقيقة. تم استرداد الشذبة ومعالجتها كعينة مستنفدة من الرنا الريباسي. تم استخدام هذا الأخير ، بالإضافة إلى المنتج الدائري المشتق من إجمالي الحمض النووي الريبي ، كقوالب لتضخيم تفاعل البوليميراز المتسلسل لإنتاج مكتبات تسلسلية باستخدام بادئات منشورة سابقًا [62] مع تغييرات طفيفة في الرموز الشريطية. تم تسلسل المكتبات الناتجة باستخدام نظام Illumina HiSeq في تسلسل DNA و Genomics Core و NHLBI و NIH. تم قطع القراءات لإزالة تسلسلات الرابط (باستخدام fastx_toolkit / fastx_trimmer [http://hannonlab.cshl.edu/fastx_toolkit/index.html] في كود سطر الأوامر ذي الصلة) ثم محاذاتها إلى S. cerevisiae قاعدة بيانات الرنا الريباسي باستخدام Bowtie [63]. تمت محاذاة القراءات التي لا تتماشى مع قاعدة البيانات المرجعية (قراءات غير الرنا الريباسي) إلى ملف S. cerevisiae الجينوم أو إلى ملف FASTA المصنوع من تسلسل المراسل (pR AUG FF UUG) لإنشاء محاذاة لمراسل F-Luc mRNA باستخدام TopHat [64].

تحليل البيانات والإحصاءات وأدوات الويب

بالنسبة إلى التنميط الريبوزومي ، تم إجراء كل تجربة باستخدام ثقافتين مستقلتين كتكرارات بيولوجية. تم إجراء التحليل الإحصائي بين التكرارات باستخدام DESeq2 [65] تتناول الحزمة الإحصائية DESeq2 التحدي النموذجي في تجارب تسلسل الجيل التالي المتمثلة في وجود مكررين بيولوجيين فقط لكل حالة عن طريق تجميع المعلومات حول تباينات أعداد القراءة عبر آلاف الجينات يجري تحليلها من أجل نمذجة تباينات العد للجينات ذات مستويات التعبير المتشابهة. تُستخدم الفروق المنمذجة في إطار نموذج خطي معمم (GLM) ، وهو امتداد للانحدار الخطي يسمح بتوزيعات الخطأ غير العادية ، لتحديد تغييرات التعبير ووضع فترات الثقة على حجم التغييرات ، وكذلك لاستبعاد الجينات التي تظهر تقلبية عالية شاذة. يمكن تحليل التغييرات النسخية والتحويلية معًا في GLM من خلال تضمين نوع المكتبة (mRNA-Seq أو Ribo-Seq) كأحد العوامل ، بالإضافة إلى المتغيرات التجريبية مثل النمط الجيني أو العلاج بالعقاقير ، في تصميم متعدد العوامل. تظهر كفاءة الترجمة (TE) كتأثير لنوع مكتبة Ribo-seq على خط الأساس mRNA-Seq ، والتفاعلات المهمة لـ TE مع المتغيرات التجريبية تشير إلى التحكم متعدية [66]. في حين أن التحليل ضعيف مع اثنين مقابل ثلاثة مكررات بيولوجية ، تزداد فقط فرصة وجود سلبيات كاذبة ، وليس إيجابية كاذبة. باستخدام DESeq2 ، قمنا بحساب التغييرات في كثافة الريبوسوم (شظايا الريبوسوم المحمية لكل مليون قراءة معينة) ، وكثافة mRNA (قراءة RNA-seq لكل مليون قراءة معينة) ، وكفاءة الترجمة (TE ، كثافة الريبوسوم / كثافة mRNA) في درجات حرارة مختلفة باستخدام قطع 10 متوسط ​​mRNA يقرأ في أربع عينات. لحساب TE من uORF (TEuORF) ، تم استخدام عدد قراءة mRNA لـ mORF بدلاً من عدد قراءة mRNA في uORF وحده لأن mORFs بها ضوضاء أقل. تم حساب ارتباط سبيرمان باستخدام أداة عبر الإنترنت على https://www.wessa.net/rwasp_spearman.wasp. تم إجراء تحليل مخطط الصندوق المسنن والشعيرات باستخدام أداة الويب http://shiny.chemgrid.org/boxplotr/. تشير الشقوق إلى ± 1.58 × النطاق الرباعي (IQR) / √ن، حيث IQR هو الفرق بين النسب المئوية 75 و 25 و ن يمثل عدد نقاط البيانات في تلك الحاوية. تعطي الشقوق غير المتداخلة ثقة بنسبة 95٪ تقريبًا باختلاف الوسيطين. تم إنشاء خرائط الحرارة باستخدام أداة الويب "Heatmapper" (http://www.heatmapper.ca/) [67].

تذبذب المسارات

تم إنشاء ملف محاذاة مدمج (ملف Bam) باستخدام ملفي محاذاة (واحد لكل من النسختين البيولوجيتين). تم إنشاء الملفات المجمعة لكل من عينات RPF وعينات RNA الإجمالية (لمدة 20 درجة مئوية و 30 درجة مئوية و 37 درجة مئوية). تم إنشاء ملفات تذبذب من ملف المحاذاة المدمج هذا. تم إنشاء ملفات لكل جين على خيط Watson أو Crick. تم تصور المسارات باستخدام عارض الجينوم التكاملي (IGV 2.4.14). تمت تسوية المسارات وفقًا للعدد الإجمالي للقراءات المعينة في الملف المدمج. لتطبيع تأثيرات التغييرات في مستويات mRNA ، تم قياس القمم الإجمالية للقراءة الطبيعية فيما يتعلق بالتغييرات في مستويات mRNA لتعكس التغييرات في كفاءة الترجمة (انظر قسم "النتائج"). تظهر مسارات تذبذب ، سواء مع أو بدون القياس بالتغييرات في مستويات الرنا المرسال.

البحث عن ORFs المنبع

اتخذنا نهجًا مشابهًا لتحديد uORFs المحتملة وتأكيد ترجمتها في تجاربنا كما هو موضح سابقًا [19]. أولاً ، تم تحديد UORFs المترجمة المفترضة بشكل أساسي على النحو الموصوف [35]. باختصار ، بالنسبة لجميع إطارات القراءة المفتوحة في 5′-UTRs المشروحة والتي تبدأ إما من AUGs أو بالقرب من الكودونات المماثلة ، فإن نسبة عدد RPF في الموضع + 1 (رمز البدء لـ uORF) إلى موضع - 1 (المنبع من كود البدء) تم حساب. هذه uORFs ذات النسب & gt 4 ، مع عدد & gt 14 RPF في الموضعين + 1 و - 1 معًا ، ومع 50٪ على الأقل من عدد القراءات في الإطار 0 فيما يتعلق بموقع البدء (أي سطر الكود ذي الصلة هو -c15-r4-z0.5) لمزيد من التحليل. تم وصف مجموعات بيانات تنميط الريبوسوم المتعددة التي استخدمناها لتحديد uORFs المحتملة سابقًا [19] وتم تقديمها إلى NCBI Gene Expression Omnibus ، وتم سرد أرقام الانضمام على https://elifesciences.org/articles/31250/figures#supp1 في ملف إضافي 2: الجدول S2. تم تقديم بيانات RNA-seq إلى NCBI Gene Expression Omnibus (GEO https://www.ncbi.nlm.nih.gov/geo) مع رقم الانضمام إلى GEO GSE137021. يتم توفير تفاصيل مجموعات بيانات RNA-seq و Ribo-seq التي تم إنشاؤها في هذه الدراسة في ملف إضافي 2: الجدول S5.

لتحديد أي من هذه uORFs المفترضة تمت ترجمته في تجاربنا ، استخدمنا أداة تحديد ORF (RibORF) الموصوفة سابقًا [36] ، والتي تستخدم دورية 3 نيوكليوتيدات وتوزيعًا موحدًا لأعداد RPFs عبر uORF كمعايير تسجيل. لقد طبقنا حدًا صارمًا بشكل معتدل لاحتمال التنبؤ بـ 0.5 واستخدمنا ملف محاذاة مدمج تم إنشاؤه من مكتبات البصمة لجميع التكرارات البيولوجية الستة التي نمت في 3 درجات حرارة مختلفة لتحديد uORFs مع دليل على الترجمة عند درجة حرارة نمو واحدة أو أكثر. بعد استبعاد uORFs الأقصر من 3 أكواد ، حددنا 1367 uORFs بدءًا من AUG (ن = 142) أو NCC (ن = 1225). تم إجراء تحديد إجمالي عدد الرنا المرسال و RPF في 5′-UTR أو uORF أو mORF كما هو موضح سابقًا [19].

لتحديد uORFs المحتملة في جميع نسخ الخميرة mRNA 5′-UTR ، تم استخراج تسلسلات 5′-UTR لجميع mRNAs ، وتم البحث في كل توائم من النوكليوتيدات AUG و NCC طوال 5′-UTR. حددنا أول كود في إطار التوقف لكل كود بدء على أنه نهاية uORF. بالنسبة إلى uORFs بدون كودون إيقاف داخل الإطار في 5′-UTR ، حددنا نهاية 5′-UTR على أنها نهاية uORF. تم استبعاد uORFs التي يقل طولها عن 3 أكواد في تحليل المصب.

توليد الحيوانات المستنسخة C- طرفيًا HA الموسومة من AGA1 الجين

تم استخدام مزيج Gibson الرئيسي للتجميع (NEB # E2611) لإنشاء علامة HA ذات علامة C نهائية AGA1 الحيوانات المستنسخة [AGA1-HA (WT) ، انظر بلازميد رقم 12 ، ملف إضافي 2: الجدول S2]. تم استخدام بروتوكول لأربع إلى ست مجموعات مجزأة. الأجزاء الأربعة المجمعة هي كما يلي: علامة HA مزدوجة الشريطة (

108 nt) ، ناقل عالي النسخ (pRS426 تم هضمه باستخدام BamHI و SacI ، متبوعًا باستخراج الهلام) ، منتج PCR (P1 ،

3000 نقطة أساس) تم الحصول عليها باستخدام التمهيدي الأمامي الرابط 650 nt من المنبع من كودون البدء والربط التمهيدي العكسي فورًا في اتجاه مجرى كود الإيقاف (على شريط Crick) من AGA1 منطقة الترميز ، ومنتج PCR (P2 ، 300 نقطة أساس) تم الحصول عليه باستخدام رابط تمهيدي أمامي على الفور في اتجاه مجرى كود الإيقاف وربط التمهيدي العكسي 300 nt في اتجاه المنبع من كود الإيقاف (على شريط Crick) من AGA1 منطقة الترميز. تم تصميم البادئات باستخدام أداة التجميع NEBuilder (v2.2.5) مع تغييرات طفيفة. تم استخدام الحمض النووي الجيني من خلايا BY4741 في جميع تفاعلات PCR. تم استخلاص الأجزاء الأربعة من الجل ثم ربطها باستخدام مزيج جيبسون الرئيسي 2 × وفقًا لتعليمات الشركة المصنعة. تم تحويل ميكروليتر واحد من التجميع إلى NEB® 5-alpha Competent بكتريا قولونية- خلايا عالية الكفاءة (# C2987) متبوعة بالاختيار على ألواح LB-carbenicillin. تم فحص المستعمرات بواسطة PCR للمستعمرة باستخدام الاشعال M13 للأمام (M13F) و M13 العكسي (M13R) ، متبوعًا برسم خرائط التقييد والتسلسل باستخدام الاشعال M13F و M13R. متحولة بدء uORF [AGA1-HA (متحولة) ، انظر البلازميد رقم 13 ، ملف إضافي 2: الجدول S2] تم إنشاؤه من AGA1-HA (WT) بلازميد بواسطة PCR سريع التغيير باستخدام PfuTurbo DNA Polymerase (Agilent Technologies # 600252). تم تأكيد الطفرة عن طريق التسلسل باستخدام التمهيدي M13F. تم اختيار خلايا الخميرة التي تحتوي على WT أو البلازميدات الطافرة على الوسائط المناسبة التي تفتقر إلى العناصر الغذائية المقابلة للعلامة (العلامات) المساعدة. تم إجراء مزارع خلايا الخميرة ، وإعداد المحللة ، وتحليل اللطخة الغربية كما هو موضح أعلاه. تم اكتشاف بروتين Aga1 الذي يحمل علامة HA على شكل C باستخدام جسم مضاد أحادي النسيلة HA (2-2.2.14) من Invitrogen (# 26183).


دعم المعلومات

الشكل S1

إن uORF في LST1 إكسون 1 ب هو محفوظ تطوريًا. أ) مقارنة بين LST1 تسلسل exon 1B-2 مع العديد من المتماثلات ، بداية من المنبع من uORF4 (أحمر ، غامق) وتنتهي عند كودون البداية لـ ORF الرئيسي (أسود ، غامق). يتم حفظ التسلسل بشكل كبير في pan troglodytes (رقم إدخال التسلسل <"type": "entrez-nucleotide" ، "attrs": <"text": "XM_003950777.1" ، "term_id": "410040514" ، "term_text": "XM_003950777.1" >> XM_003950777.1 ، هوية 100٪) و macaca mulatta (NW 001116486.1 ، هوية 95٪). علاوة على ذلك ، يتم حفظ التسلسل جزئيًا في sus scrofa (<"type": "entrez-nucleotide" ، "attrs": <"text": "NC_010449.4" ، "term_id": "347618787" ، "term_text": " NC_010449.4 ">> NC_010449.4 ، هوية 76٪ ، 16 فجوة) و bos taurus (<" type ":" entrez-nucleotide "،" attrs ": <" text ":" NC_007324.5 "،" term_id " : "355477170" ، "term_text": "NC_007324.5" >> NC_007324.5 ، هوية 74٪ ، 8 فجوات). من الجدير بالذكر أنه في sus scrofa و bos taurus لا يتم حفظ كود الإيقاف الخاص بـ uORF4. ب) مقارنة تسلسل الأحماض الأمينية المشفرة بواسطة uORF4 مع العديد من المتماثلات. يتم حفظ التسلسل بشكل كبير في عموم الكهوف (هوية 100 ٪) و macaca mulatta (هوية 89 ٪). ومع ذلك ، في sus scrofa (67٪ هوية ، 5 فجوات) و bos taurus (39٪ هوية ، 2 فجوات) التسلسل محفوظ جزئيًا فقط. لاحظ أنه في bos taurus uORF4 أطول منه في الإنسان العاقل (45 مقابل 38 من الأحماض الأمينية) وأنه في sus scrofa بسبب عدم وجود كودون توقف uORF4 في الإطار مع ORF الرئيسي ، وبالتالي يشكل uAUG بدلاً من uORF.

الشكل S2

نواقل التعبير المستخدمة في هذه الدراسة. نظرة عامة على نواقل التعبير المستخدمة في هذه الدراسة. تم استنساخ التسلسلات الموضحة في موقع الاستنساخ المتعدد (MCS) لمواقع قطع إنزيم تقييد ناقلات pEGFP-N1 المستخدمة في الاستنساخ بخط عريض. يتم تمييز تسلسل exon و MCS لـ pEGFP-N1 ، ويتم تمييز رمز البداية لـ uORF4 و EGFP ORF الرئيسي باللون الرمادي. يشار إلى الأحماض الأمينية المشفرة بواسطة uORF4 و ORF الرئيسي أسفل تسلسل الحمض النووي. لاحظ أن جميع التركيبات تحتوي على ATG في exon 2 وترميز ORF7 ، وهذا exon موجود في جميع نصوص LST1 ، وبالتالي لا يتم تنظيم استخدامه بواسطة الآليات التي تم فحصها في هذه الدراسة. أدى استنساخ تسلسل exon 1B-2 و 1 C-2 في ناقل pEGFP-N1 إلى حذف 14 نيوكليوتيدًا موجودًا في الجزء العلوي من LST1 ORF الرئيسي. في ناقلات التعبير هذه ، يسبق EGFP ORF 19 نيوكليوتيدات من pEGFP-N1 MCS. تتضمن نواقل التعبير Exon1B-EGFP و Exon1B-AUGdel-EGFP و Exon1B-frameeshift-EGFP تسلسلًا طويلًا 23 نقطة أساس مخصصة لـ intron 1A ، ويرجع ذلك إلى غموض تسلسل exon 1B المنشور. تم تصنيف التسلسل الموضح هنا وفقًا لـ [10] ، ومع ذلك تشير دراسة ثانية إلى تسلسل exon 1B لبدء 23 نقطة أساس في المنبع [8].

الشكل S3

ال LST1 تسلسل exon 1B يمنع تعبير البروتين. تم نقل خلايا هيلا باستخدام الحمض النووي الريبي المنسوخ في المختبر (ivt RNA) من تركيبات التعبير التي تشفر بروتين الفلورسنت الأحمر mCherry وإما ناقل تعبير EGFP أو بناء اندماج Exon1B-EGFP. (أ) تحليل التدفق الخلوي لكثافة EGFP في نواقل هيلا التي تعبر عن Exon1B-EGFP ivt RNA (الخط الأصفر) أو EGFP ivt RNA (الخط الأزرق). يتم عرض الخلايا غير المنقولة كمنحنى رمادي خالص. تم استخدام تعبير mCherry لبوابة واختيار transfectants إيجابية ، والتي تم تحليلها لشدة تعبير EGFP. (ب) تحليل التدفق الخلوي الكمي لتعبير EGFP في نباتات هيلا. تم إجراء تحليل تعبير EGFP كما هو موضح في (أ) وتم قياس شدة متوسط ​​مضان. تم تعيين قيمة 100٪ للخلايا المنقولة باستخدام IVT RNA من ناقل EGFP غير المعدل. يشار إلى القيم المتوسطة من 3 تجارب مستقلة داخل الأعمدة + / & # x02212 sd. عرضت Transfectants التي تعبر عن Exon1B-EGFP مستويات تعبير EGFP منخفضة بشكل ملحوظ عند مقارنتها بالخلايا المنقولة باستخدام IVT EGFP RNA (p & # x0200a = & # x0200a0.049).

الشكل S4

إن uORF في LST1 يثبط إكسون 1 ب تعبير البروتين. HEK-293T cells were cotransfected with expression constructs encoding the red fluorescent protein mCherry and either an EGFP expression vector, Exon1B-EGFP, Exon1B-AUGdel-EGFP or Exon1B-frameshift-EGFP fusion constructs. (A, B) Flow cytometry analysis of EGFP intensity in HEK-293T transfectants expressing Exon1B-EGFP (yellow line), Exon1B-AUGdel-EGFP, Exon1B-frameshift-EGFP (green line in A and B, respectively) or the unmodified EGFP vector (blue line). Untransfected cells are displayed as a solid grey curve. The mCherry expression was used to gate and select positive transfectants, which were analysed for the intensity of EGFP expression. (C, D) Quantitative flow cytometry analysis of EGFP expression in HEK-293T transfectants. The analysis of EGFP expression was performed as described in (A, B) and the mean fluorescence intensity was quantified. A value of 100% was set for cells transfected with the unmodified EGFP vector. Mean values from 5 independent experiments are indicated within the columns +/− s.d. Transfectants expressing Exon1B-EGFP displayed significantly reduced EGFP levels when compared with cells transfected with the empty vector (p =𠂠.009). The expression of the Exon1B-AUGdel-EGFP vector, in which the start codon of the uORF was mutated, was comparable to the expression of the unmodified construct. Expression of the Exon1B-frameshift-EGFP construct, in which a frameshift mutation shortens the uORF, was significantly stronger when compared to cells transfected with the Exon1B-EGFP vector (p =𠂠.049), but still considerably weaker than the expression of the unmodified vector.

Figure S5

Quantification of EGFP transcript expression in transfectants using qPCR. HeLa (A) and HEK-293T (B) cells were transfected with either an EGFP expression vector, Exon1B-EGFP, Exon1C-EGFP, Exon1B-AUGdel-EGFP or Exon1B-frameshift-EGFP fusion constructs. Total RNA was isolated from transfectants and cDNA was synthesised. كمية EGFP transcripts was assayed by quantitative PCR. EGFP transcript expression was first normalised for GAPDH and then for expression of the neomycin resistance gene. The later was performed to compensate for fluctuations in transfection efficiency, as the neomycin resistance gene is present in all expression vectors. A value of 100% was set for cells transfected with the unmodified EGFP vector. Mean values from 3 independent experiments are indicated within the columns +/− s.d. Both HeLa and HEK-293T cells transfected with either the unmodified EGFP expression vector or any of the fusion constructs employed in this study displayed comparable EGFP transcript levels.


RESULTS

Previously, we have demonstrated that VEGF can be generated through both AUG initiated translation and cleavage of a larger L-VEGF precursor protein that is initiated from one of multiple upstream, in frame CUG codons (25). In order to detect differences between translational initiation at AUG and CUG codons for each VEGF mRNA splice variant, we constructed expression plasmids containing VEGF 121, VEGF 165 or VEGF 189 with mutated signal peptide sequences (40).

The VEGF 121 AUG shut-off requires the full-length mRNA sequence

Using this approach, we have demonstrated that translation initiation at a CUG is always efficient regardless of which splice variant is expressed, whereas initiation at the AUG depends upon which exons are present in the mRNA (40). VEGF 121 is expressed through initiation events using the CUG start codons, which only generate high molecular weight L-VEGF. In contrast, VEGF 189 and 165 splice variants lead to the production of both CUG and AUG-initiated proteins ( Figure 2 A).

To determine how the alternatively spliced VEGF sequence influences the initiation-codon choice, we fused the first exon of VEGF, containing the 5′UTR, in-frame AUG start codon and mutated signal peptide, with the CAT reporter gene and inserted at the 3′ end the sequence corresponding to exons 5 to 8 of VEGF 121, 165 or 189. Translation initiation still occurred at both CUG codons and the AUG codon, disregardless of the VEGF sequence fused at the 3′ end ( Figure 2 B). This shows that the mere presence of the VEGF 121 isoform specific primary sequence was not sufficient to reproduce the AUG blockade. We can conclude that the VEGF 5𠄸 alternative exons influence the choice of the initiation codon only in the context of the full length VEGF mRNA. Consequently, we hypothesized that the AUG shut-off in the VEGF 121 mRNA depends upon RNA structures that require continuity from the 5′UTR to the vicinity of the stop codon. These results highlight the role of the full VEGF mRNA sequence in this regulation and suggest that there is something specific within the VEGF 121 isoform sequence that inhibits AUG initiated translation.

Role of the 5′UTR in the VEGF 121 AUG shut-off mechanism

It was previously established that an alternative promoter is positioned within the human VEGF 5′UTR (15). The +1 transcription initiation site is located at +633 downstream from the classical start site. Furthermore, the internal promoter's insensitivity to hypoxia indicates that it is used independently of the main promoter region. Moreover, transcripts initiated from the internal promoter are of special interest because they cannot encode L-VEGF isoforms. In addition, these transcripts can be translated by either a cap-dependent or IRES-A-dependent mechanism from the AUG codon (15).

The role of the two 5′ sequences was investigated by comparing the expression of each splice variant fused to the different 5′UTRs. A deletion of most of the VEGF 5′UTR (24 remaining nucleotides) was used as a control ( Figure 3 , lanes 2). VEGF 165 and 189 AUG initiated form was expressed, disregardless of the length of the 5′UTR ( Figure 3 A), while VEGF 121 AUG initiated form was only detectable from the control construct ( Figure 3 A, VEGF 121, lane 2). The integrity of all mRNAs expressed after transfection was verified by northern blot (Supplementary data). Quantification of these mRNAs was determined by RNase protection assays ( Figure 3 ). For each spliced variant, we can see that VEGF mRNAs are expressed at comparable levels, indicating that the lack of the 121 AUG initiated form ( Figure 3 A lanes 1 and 3) is due to a posttranscriptional regulation.

To examine this regulation in a more physiological context, minigene plasmids were constructed (see materials and methods). These minigene constructs should allow, after alternative splicing of the pre-mRNA, the expression of the different VEGF isoforms. While alternative splicing generating VEGF 189 was very inefficient in HeLa cells, results obtained with VEGF 121 and 165 parallel those obtained with the cDNA constructs ( Figure 3 B) and only the construct lacking a 5′UTR permitted expression of the VEGF 121 AUG initiated form ( Figure 3 B, lane 2). Since we have previously shown that the half-lives of the VEGF 121, 165, and 189 proteins are very similar (40), we investigated whether this regulation was exerted through a translational regulation mechanism and we examined the association of the different transcripts with polysomes. For transfections using full-length constructs ( Figure 4 , lane 1𠄳), mRNAs associated with polysomes were recovered. Identical results were obtained with constructs in which VEGF 165 and 189 transcripts began at the internal promoter ( Figure 4 , lanes 4, 5). The same construction with VEGF 121 clearly showed a very poor association of this mRNA to polysomes ( Figure 4 , lane 6). Because the northern blot is not discriminative enough to identify the different VEGF mRNA isoforms, we analyzed the VEGF mRNA distribution by RT–PCR after transfection with the IP minigene construct. Interestingly, VEGF 165 mRNA was present in fractions containing heavy polysomes, whereas the 121 encoding mRNA was found to be recovered only in the free mRNA, monosome and disome fractions ( Figure 4 , lane 7). These results corroborate those obtained with cDNA transfections and reinforce the previous finding showing that the AUG shut-off mechanism of VEGF 121 is independent of the splicing mechanism.

The minimal 5′ region involved in the control of the AUG usage contains a small ORF

A deletion analysis was performed to locate the minimal sequence responsible for the AUG translational blockade of VEGF 121 starting with the region between position 633 (IP) and 24 nt upstream from the AUG ( Figure 5 A). It is clear that the 200 nt upstream from the AUG were sufficient to mediate the specific AUG blockade of VEGF 121 ( Figure 5 A, lanes 4) and the region between 100 and 200 was necessary for this effect ( Figure 5 A, lanes 3 versus 4). These results were confirmed by those obtained with the minigene constructs ( Figure 5 A).

Identification of the minimal region involved in translation initiation control. (أ) Left, schematic representation of the deletion within the 5′ leader performed in the IP constructs encoding the three VEGF isoforms and the minigene. Right, expression of AUG-initiated VEGF isoforms were analyzed by western immunoblotting using an anti-HA antibody. Anti-β-actin was used to control protein loading. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantity. (ب) Partial alignment of the VEGF mRNA 5′ untanslated region of several species. Conserved nucleotides are shown in red. Main VEGF AUG translation initiation codons (on the right) are framed. The lower part shows a magnification of the region containing the uORF. The uORF, extremely well conserved among several species, is positioned in +1 frame relative to the VEGF ORF in human mRNA. This uORF would be initiated at uAUG (position 852) and be terminated at position 863, 175 nucleotides upstream from the VEGF AUG, and would produce a putative three amino-acid long polypeptide.

It is well documented that the 5'UTRs of vertebrate mRNAs contain a variety of features that affect the translation efficiency of the main coding sequence (44). These include the length and putative secondary structures of the 5'UTR, the sequence context of the initiation codon as well as the presence of upstream AUG codons (uAUGs). Interestingly, inspection of the human VEGF 5’UTR revealed the presence of a unique and short uORF precisely within the region between 200 and 100 nucleotides upstream of the AUG initiation codon. This uORF is highly conserved between species ( Figure 5 B) and begins at AUG 852, which is 186 nucleotides upstream from the main AUG (using the human sequence).

We first investigated whether this uORF was translated. Since it is impossible to visualize the encoded tripeptide, the uORF stop codon was mutated so that initiation at the uAUG would generate a 62 AA amino-terminally extended VEGF. This extended VEGF protein was always detected ( Figure 6 , lane 1) demonstrating that the uAUG was efficiently used whatever the splice variant. A consequence of this construction is the loss of the VEGF AUG 1038 initiated form.

Role of the uORF in the translational initiation control. Left, schematic representation of construct with uORF mutation. The internal promoter beginning constructs encoding each VEGF isoform or the VEGF minigene either with wild type uORF (pIP121mSPHA, pIP165mSPHA, pIP189mSPHA and pIPminiVEGF numbered 3), a mutated uORF AUG (pIP121mORFmSPHA, pIP165mORFmSPHA, pIP18mORFmSPHA and pIPminiVEGFmORF numbered 2) or a mutated uORF stop codon, which made the uORF in frame with the VEGF-HA (pIPmSOmSP121HA, pIPmSOmSP165HA, pIPmSOmSP189HA and pIPminiVEGFmSO numbered 1). Right, expression of AUG-initiated VEGF isoforms and uORF were analyzed by western immunoblotting using an anti-HA antibody and anti-β-actin to control loading of protein. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantitation.

To gain an insight into the role of the uORF, we mutated the uAUG. This mutation increased AUG 1038 initiation translation of VEGF 121 isoform, but had no effect on the VEGF 165 or 189 expression level ( Figure 6 , lanes 2 and 3). Remarkably, results obtained with the minigene construct exactly parallel those achieved with the cDNA constructs ( Figure 6 , right panel).

Taken together, these data demonstrate that the uORF serves as a cis acting regulatory element for VEGF protein isoform expression.

Translation of the uORF is mostly cap-independent

Since the uORF is located within IRES-A, we investigated whether the uAUG was translated by a cap- or IRES-dependent mechanism. In order to accomplish this, we performed a knockdown directed against the cap-binding protein eIF4E using a validated siRNA. As shown in Figure 7 , the eIF4E knockdown inhibited most of the synthesis of the 121 or 189 control constructs (Ct) in which the IRES sequences were deleted. Remarkably, expression from the VEGF 189 AUG in a wild-type ( Figure 7 , WT) context was unaffected by the inhibition of cap-dependent translation indicating that the VEGF AUG is completely IRES-dependent. As expected, the VEGF 121 AUG initiated form remained undetectable ( Figure 7 , WT). Finally, we can see that the uAUG is principally cap-independent for both the 121 and 189 constructs ( Figure 7 , mStop). One can postulate that the uAUG is able to exhaust small ribosomal subunits recruited at the cap site, since modest cap-dependent initiation was detected downstream, at the VEGF AUG ( Figure 7 , mStop).

Translation of the uORF after eIF4E knockdown. Left, schematic representation of construct with uORF mutation (described in the legend of Figure 6). Right, following eIF4E (+) or control (−) siRNA transfection, expression of AUG-initiated VEGF 121 and 189 isoforms constructs (schematized on the left) were analyzed using an anti-HA antibody and anti-β-actin to control loading of protein. Anti-eIF4E was used to verify knockdown efficiency. RPA analyses were performed to normalize transfection with a vector specific probe to quantify mRNA from transfection and with a β-actin probe to control RNA quantitation.


مناقشة

Understanding of molecular mechanisms regulating utrophin expression may have therapeutic benefit because of utrophin’s potential to functionally compensate dystrophin deficiency in DMD. Two to four fold upregulation of utrophin is believed to be sufficient for complete amelioration of dystrophic phenotype in the disease [8, 39]. Although transcriptional control of utrophin expression is relatively well documented, its upregulation level sufficient for therapeutic benefit has never been reached. This may be due to inefficient translation of utrophin-A, the muscle specific isoform. Translational repression of utrophin-A is mediated through two major components: 3' and 5'-UTRs. Regulation through 3'-UTR could at least partially be explained by miRNA targets and AU rich element [22, 25–27]. However, 5'-UTR mediated repression of utrophin-A is quite puzzling, primarily because of its reported IRES activity [23]. In the same 5'-UTR simultaneous existence of inhibitory property and IRES, the cis-acting element mostly associated with translational upregulation demands in depth understanding. The present work is an effort towards this direction.

The evidence in favor of utrophin-A IRES came from DNA based dicistronic construct based assay. In the dicistronic construct insert to be tested is flanked between two reporter ORFs and two cistrons remain under the control of single but strong promoter. Expression of second cistron has been considered as the proof of IRES activity. In this strategy although second cistron is expressed for IRES elements, cryptic promoter and alternative splicing may also lead to the same. Therefore all the IRESes identified through dicistronic DNA construct based strategy, especially of cellular origin are now under question. We therefore tested utrophin-A 5'-UTR with more stringent strategy [28, 29, 33]. Luciferase reporter having 5'-UTR was في المختبر transcribed, either m7G-capped or A-capped and then expression of reporter was monitored upon transfection in cultured cells. A-capped RNA cannot be translated through cap-dependent mechanism and therefore any activity of reporter represents its cap-independent translation. With A-cap we detected almost 80% activity of m7G-capped transcript (Fig 1). However the overall activity is quite low compared to EMCV IRES. We therefore conclude that firstly, utrophin-A 5'-UTR although confers IRES activity, it is not as strong as EMCV counterpart and secondly, its contribution becomes enormous because of severe repression of cap-dependent translation.

In order to investigate utrophin-A 5'-UTR mediated inhibition of cap-dependent translation, we asked whether any region within it confers repressor activity. With deletion mutagenesis, we addressed this issue using في المختبر transcribed reporter RNA. Transfection based reporter assay identified two regions whose deletion upregulated expression of downstream reporter with m7G-capped transcript. These two sequences in utrophin-A 5'-UTR therefore inhibit cap-dependent translation. Our result suggests that

125 nt long region at 5’terminus is crucial for severe inhibition in cap-dependent and has no effect on IRES. Its deletion upregulated

25 fold reporter activity. This 125 nt sequence has predicted complex secondary structure and presence of structural elements close to 5' end inhibits binding of 40S ribosomal subunit with cap [40]. Another region, present between 255–302 nt in 5'-UTR moderately inhibits cap-dependent translation, however it seems important for IRES (Fig 3).

Investigations on upstream ORF (uORF) within 5'-UTR for many transcripts have demonstrated their inhibitory effect on translation [41]. In mouse utrophin-A 5'-UTR a short uORF is present. We therefore asked whether this uORF in utrophin-A 5'-UTR confers any inhibitory effect on downstream ORF. Elimination of utrophin-A uORF upregulated downstream reporter activity with m7G-capped RNA. It therefore identified another inhibitory element in utrophin-A 5'-UTR (Fig 4).

In conclusion, the present study demonstrates that utrophin-A 5'-UTR supports cap-independent translation. Utrophin-A IRES although not as strong as EMCV IRES, in the context of severe repression of cap-dependent translation, plays crucial role. The inhibition of cap-dependent translation is mediated through two cis-acting sequence elements and one short uORF. Among these three elements the sequence element present at 5' terminus appears most potent. The observations presented in this paper may therefore lead to the development of strategies to de-repress utrophin translation.


مقدمة

The human genome contains many regions encoding potential functional small peptides outside the canonical protein-coding regions 1 . Some upstream open reading frames (uORFs), which are located in the 5′-untranslated regions (5′-UTRs) of mRNAs, have been shown to encode such functional small peptides 2,3,4,5 . uORFs are cis-acting regulatory elements that control the translation of protein-coding main ORFs (mORFs) in various ways 6,7 . In eukaryotes, 43S pre-initiation complexes (PICs) scan for a start codon along an mRNA from the 5′ end. Therefore, PICs can recognize the start codon of a uORF and translate the uORF before reaching the downstream mORF. In many cases, after translating a uORF, ribosomes dissociate from the mRNA or small ribosomal subunits remain bound to the mRNA and resume scanning. When ribosomes dissociate from the mRNA after uORF translation, ribosomes that have translated the uORF do not translate the downstream mORF. Therefore, if the translation initiation efficiency of the uORF is high, the uORF exerts a substantial repressive effect on mORF translation 6,7 . When a small ribosomal subunit resumes scanning after uORF translation, the ribosomes can reinitiate translation at a downstream AUG codon. However, the reinitiation efficiency depends on the time needed for the uORF translation and the distance between the uORF stop codon and the downstream start codon 8,9,10,11 . The intercistronic distance required for efficient reinitiation depends on cellular availability of the ternary complex that comprises eukaryotic initiation factor 2 (eIF2), GTP, and Met-tRNAأنا Met , and the level of the available ternary complex is reduced under starvation or stress conditions 12 . These properties are utilized for the translational regulation of yeast GCN4 and mammalian ATF4 و ATF5 mRNAs 13,14,15,16,17,18 . In these mRNAs, there is an inhibitory uORF downstream of the uORF that allows reinitiation. Under normal conditions, reinitiation preferentially occurs at the start codon of the inhibitory uORF, and therefore, mORF translation is repressed. In contrast, under starvation or stress conditions, reinitiation is delayed due to the reduced availability of the ternary complex, and therefore, ribosomes more frequently bypass the inhibitory uORF and reinitiate translation at the start codon of the mORF, resulting in enhanced mORF translation. Apart from mORF translation control, uORFs can affect mRNA stability through the nonsense-mediated RNA decay pathway 19 . While the effects of most uORFs on the expression of the mORF-encoded proteins are independent of the uORF-encoded sequences, certain uORFs repress mORF translation in a peptide sequence-dependent manner. Most of these uORFs encode regulatory peptides that cause ribosome stalling by interacting with components of the ribosomal exit tunnel during uORF translation 4 . Ribosome stalling on a uORF results in translational repression of the downstream mORF because the stalled ribosomes block the scanning of subsequently loaded PICs and prevent them from reaching the start codon of the mORF 20 . In some genes, uORF-encoded peptides are involved in translational regulation in response to metabolites or environmental stresses, whereby the uORF translation initiation efficiency or the efficiency of ribosome stalling is regulated in a condition-dependent manner 4,21 . In the sequence-dependent regulatory uORF of the mouse antizyme inhibitor (AZIN1) gene, which begins with a non-canonical start codon 22 , polyamine induces ribosome stalling, and the stalled ribosome causes ribosome queuing by blocking the scanning of PICs 23 . This ribosome queuing promotes translation initiation at the non-canonical start codon of the uORF by positioning PICs near the start codon, thereby enhancing the repressive effect of the uORF on mORF translation. Apart from uORFs encoding regulatory peptides, some uORFs have been reported to code for proteins with functions independent of the control of the downstream mORF 24,25,26 .

To comprehensively identify uORFs encoding functional peptides or proteins, genome-wide searches for uORFs with conserved peptide sequences (CPuORFs) have been conducted using comparative genomic approaches in plants 27,28,29,30,31,32 . To date, 157 CPuORF families have been identified by comparing 5′-UTR sequences among plant species. Of these, 101 families were identified in our previous studies by applying our original methods, BAIUCAS 29 and ESUCA (an advanced version of BAIUCAS) 32 to the genomes of أرابيدوبسيس, rice, tomato, poplar, and grape.

ESUCA has many unique functions 32 , such as efficient comparison of uORF sequences among an unlimited number of species using BLAST, automatic determination of taxonomic ranges of CPuORF sequence conservation, systematic calculation of كأ/كس ratios of CPuORF sequences, and wide compatibility with any eukaryotic genome whose sequence database is registered in ENSEMBL 33 . By comparing uORF sequences from certain species and those from many other species whose transcript sequence databases are available, ESUCA enables more comprehensive identification of CPuORFs conserved in various taxonomic ranges than conventional comparative genomic approaches, in which uORF sequences are compared among limited numbers of selected species. In addition, to distinguish between “spurious” CPuORFs conserved because they encode parts of mORF-encoded proteins and “true” CPuORFs conserved because of the functional constraints of their encoded small peptides, ESUCA assesses whether a transcript containing a fusion of a uORF and an mORF is a major or minor form among homologous transcripts 32 . By using these functions, ESUCA is able to efficiently identify CPuORFs likely to encode functional small peptides. In fact, our recent study demonstrated that poplar CPuORFs encoding regulatory peptides were efficiently identified using ESUCA by selecting ones conserved across diverse eudicots 32 .

Several studies on genome-wide identification of animal CPuORFs have been reported. By comparing uORF sequences between human and mouse, 204 and 198 CPuORFs have been identified in human and mouse, respectively 34 . In addition, by comparing uORF sequences among several species in dipteran, 44 CPuORFs have been identified in fruit fly 35 . More recently, among translatable uORFs identified by ribosome profiling studies, 118, 80, 13, 50, and 37 CPuORFs in human, mouse, zebrafish, fruit fly, and nematode, respectively, have been identified by Mackowiak et al. 36 , and 97 CPuORFs in human have been identified by Samandi et al. 26 . In these previous studies, uORF sequences were compared between a limited number of species. Therefore, further comprehensive identification of animal CPuORFs was expected by applying the approach using ESUCA to animal genomes. In addition, the relationships between the taxonomic ranges of CPuORF conservation and the likelihood of having a regulatory function have not been studied in animals.

Accordingly, in this study, we applied ESUCA to the genomes of fruit fly, zebrafish, chicken, and human to exhaustively identify animal CPuORFs and to determine the taxonomic range of their sequence conservation. Using ESUCA, we identified 1517 animal (1373 novel and 144 known) CPuORFs belonging to 1430 CPuORF families. Using transient expression assays, we examined the effects of 17 CPuORFs conserved in various taxonomic ranges on mORF translation. Through this analysis, we identified seven novel regulatory CPuORFs that repress mORF translation in a sequence-dependent manner.


Electronic supplementary material

12864_2009_2749_MOESM1_ESM.PDF

Additional file 1: Genes containing uAUGs that do/do not interact with 3'-ends of conserved miRNAs. GO-term analysis for two categories of genes that contain uAUGs. The first category consists of genes with uAUGs that are predicted to interact with 3'-ends of conserved miRNAs (likely targets). The second category of genes contains uAUGs but shows no such interactions. (PDF 57 KB)

Predicted interactions between uAUG 6 and 7 (Table 5) of

Additional file 2: KLF9 and conserved miRNAs. uAUG6 and uAUG7 are thought to be responsible for limiting translation of KLF9 in HeLa cells but not in N2A. Predicted binding between both ends of conserved miRNAs in Table 5 and the two uAUGs are shown. (PDF 116 KB)


شاهد الفيديو: أمثلة مضحكة عندما يعتمد المترجم على ترجمة جوجل! (شهر نوفمبر 2022).