معلومة

كيف يصل البروتين إلى ركائزه داخل الخلية؟

كيف يصل البروتين إلى ركائزه داخل الخلية؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

بعد تخليق البروتين واعتماده النهائي الثلاثي / الرباعي ، كيف يصل إلى ركائزه داخل الخلية وما الذي يجعله يتفاعل معها؟

عوامل النسخ لجين معين هي بروتينات تُترجم من جينات على جزء آخر من الحمض النووي. (يحدث هذا في السيتوبلازم) ولكن كيف تعرف عوامل النسخ أنه يجب أن ينتشر في منطقة الحمض النووي للنواة.


لا يتحرك البروتين نحو أي شيء. ينتشر (يرتد) بشكل عشوائي في الخلية حتى يلتصق بشيء ما. سيحدد التركيب الكيميائي الخاص (الشكل) للبروتين وأي شيء يضربه مدى تماسكهما معًا وما إذا كان هناك تفاعل كيميائي يحدث أم لا.

طريقة لتخيل ذلك هي التفكير في جرة مليئة بالكثير من الرخام الزجاجي (الماء) ، ومغناطيس على شكل رخامي (البروتين) ، ورخام واحد معدني (الركيزة). ضع المغناطيس في الأسفل ، املأ الجرة معظم الطريق بالرخام الزجاجي ، ثم ضع الرخام المعدني في الأعلى. ثم أغلق الجرة ورجها. في النهاية ، بعد الاصطدام بالكثير من الرخام الزجاجي ، سوف يصطدم المغناطيس والرخام المعدني ويلتصقان ببعضهما البعض. هذه هي الطريقة التي تعمل بها في الخلايا أيضًا. في الخلايا ، تتناسب السرعة التي تتحرك بها الجزيئات مع درجة الحرارة.

إليك مقطع فيديو رائع يوضح كيف يمكن للبروتينات ذات الشكل المحدد جدًا والتي ترتد بشكل عشوائي أن تتجمع في بنية معقدة.

للتعرف على مدى سرعة تحرك الجزيئات في الخلية ، فكر في خلية بكتيرية. ان بكتريا قولونية يبلغ قطر الخلية حوالي 1 ميكرومتر. في خلية بهذا الحجم بدون مقصورات خلوية فرعية ، سيصطدم كل جزيء مع كل جزيء آخر في الخلية مرة واحدة تقريبًا كل ثانية (إذا افترضنا بعض الافتراضات مثل عدم الارتباط بجزيئات أخرى). لذلك إذا كانت الخلية تحتوي على وحدة واحدة فقط من إنزيم معين ، وجزيء واحد فقط من ركائزها ، فستظل تتصادم بشكل متكرر إلى حد ما (مرة واحدة كل ثانية تقريبًا).

ينخفض ​​هذا المعدل بشكل كبير مع زيادة نصف قطر الخلية. على سبيل المثال ، خلية بقطر مضاعف (2 ميكرومتر) لها حجم أكبر بثماني مرات ، لذا فإن التصادمات بين أي جزيئين تستغرق 8 مرات (2 ^ 3 دولار) من الوقت لتحدث (بمعنى آخر ، تستغرق الجزيئات 8 مرات وقتًا أطول "تجد" بعضها البعض). هذا هو أحد أسباب وجود نوع من الحد الأعلى لحجم خلية فردية. الكائنات الحية الأكبر تكون أكبر لأن لديها خلايا أكثر ، وليس لأنها تحتوي على خلايا أكبر.

يسمى مجال علم الأحياء المعني بمدى احتمالية حدوث تفاعل بحركية الإنزيم. يُطلق على المجال ذي الصلة ، الذي يتعامل مع مدى تكرار تصادم الجزيئات ، الميكانيكا الإحصائية.


توصيل ركائز منتشرة إلى آلات تكشف البروتين

أظهر العمل الأخير أن التواجد في كل مكان يؤدي إلى التعرف على البروتينات المستهدفة من خلال مستقبلات يوبيكويتين المتنوعة. تقوم عائلة واحدة من المستقبلات بتسليم البروتينات المنتشرة في كل مكان إلى البروتيازوم مما يؤدي إلى ظهور الركيزة المعتمدة على ATP وانحلال البروتين. يبدو أن عائلة ذات صلة من البروتينات المرتبطة باليوبيكويتين تقوم بتجنيد بروتينات منتشرة في Cdc48 ، وهو مركب حلقي ATPase يمكنه أيضًا الكشف عن البروتينات. يبدو أن بعض الأهداف ترسو في Cdc48 قبل أن يفعل البروتيازوم ، في مسار مرتب. إن التفاعل الحميم بين البروتيازوم و Cdc48 ، الذي يتم التوسط فيه جزئيًا بواسطة مستقبلات يوبيكويتين المرتبطة بشكل فضفاض ، له وظائف مهمة في التنظيم الخلوي.


مقدمة

يُعتقد عمومًا أن البروتينات يتم نقلها عبر قناة موصلة للبروتين لغشاء ER في شكل غير مكتمل. في النقل الجماعي ، يتم الحفاظ على الحالة غير المطوية ببساطة من خلال حقيقة أن سلسلة البولي ببتيد الوليدة يتم نقلها أثناء تصنيعها على ريبوسوم مرتبط بقناة الغشاء. في المقابل ، بالنسبة للبروتينات المنقولة بعد الترجمة ، يجب أن تكون هناك آلية تمنع تراكمها أو طيها المبكر في بنية مستقرة قبل أن يتم نقلها عبر القناة. من المحتمل أن تشارك مرافقات العصارة الخلوية في الحفاظ على ركيزة الانتقال في شكل غير مطوي أو مطوي بشكل فضفاض قبل أن تدخل القناة (Chirico et al. 1988 Deshaies et al. 1988 Zimmermann et al. 1988 Caplan et al. 1992 Chirico 1992). ومع ذلك ، فإن هوية المرافقين والآلية التي يعملون بها لا تزال غير معروفة إلى حد كبير. بالإضافة إلى ذلك ، بمجرد الارتباط بالركيزة ، يبدو أن المرافقات والبروتينات الخلوية المتفاعلة الأخرى تشكل مشكلة لخطوة الانتقال اللاحقة. كيف يتم تحريرها للسماح لسلسلة البولي ببتيد بالانزلاق عبر القناة؟ أحد الاحتمالات هو وجود آلية نشطة يتم بواسطتها إطلاقها عندما ترتبط الركيزة بالقناة أو تنتقل عبرها. بدلاً من ذلك ، قد يحدث الإطلاق تلقائيًا في العصارة الخلوية ، وقد تلتقط قناة الغشاء سلاسل عديد الببتيد الحرة فقط.

يحدث الانتقال بعد الترجمة في كل من الخميرة وخلايا الثدييات ، على الرغم من أنه في الحالة الأخيرة يتم نقل ركائز أصغر من 70 حمضًا أمينيًا فقط ولم يتم فهم آلية النقل جيدًا (Zimmermann et al. 1988). أظهرت الدراسات التي أجريت على الخميرة أن قناة النقل بعد الترجمة تتكون من مركب بروتين غشائي مكون من سبعة مكونات ، مجمع Sec (بانزنر وآخرون 1995). يربط مجمع Sec ركيزة النقل من خلال تسلسل إشاراتها. يتم إقحام الأخير في مجالين عبر الغشاء للوحدة الفرعية Sec61p للمجمع ، مما يؤدي إلى إدخال سلسلة البولي ببتيد في القناة كحلقة (Plath et al. 1998). تتضمن الحركة اللاحقة للسلسلة عبر القناة وظيفة Lumenal Kar2p (وتسمى أيضًا BiP) ، وهي عضو في عائلة بروتين الصدمة الحرارية (Hsp70) 70 كيلو دالتون في تجويف ER (Vogel et al. 1990 Brodsky و Schekman 1993). على الأقل في حالة عامل نقل الركيزة prepro-α (ppαF ، 165 من الأحماض الأمينية) ، يمكن أن يعمل Kar2p كسقاطة جزيئية لتحريك سلسلة البولي ببتيد عبر الغشاء (Matlack et al. 1999). يرتبط بسلسلة البولي ببتيد الواردة ويمنع انزلاقها عبر القناة.

تشمل مرافقات العصارة الخلوية المتورطة في انتقال البروتين بعد الترجمة Hsp70 وعامله المساعد ، بروتين J Ydj1p (Chirico et al. 1988 Deshaies et al. 1988 Zimmermann et al. 1988 Caplan et al. 1992 Becker et al. 1996). التجارب في خميرة الخميرة أظهرت أن طفرات فقدان الوظيفة في الجينات المقابلة تؤثر على انتقال بعض البروتينات (Deshaies وآخرون ، 1988 Caplan et al. 1992 Becker et al. 1996). بالإضافة إلى ذلك ، قدمت التجارب البيوكيميائية دليلًا على أن Hsp70 يمكن أن ترتبط بالركيزة ppαF ويمكنها تحفيز انتقالها بعد الترجمة في المختبر (Chirico et al. 1988 Chirico 1992). من غير المعروف ما إذا كانت المرافقون بخلاف نظام Hsp70 – Ydj1p يتفاعلون مع ركائز نقل ما بعد الترجمة. بشكل ملحوظ ، ومع ذلك ، فإن بروتينات العصارة الخلوية ليست ضرورية لعملية الانتقال في حد ذاتها. يمكن تجاوز متطلبات الارتباط وإطلاق عوامل العصارة الخلوية عن طريق تغيير طبيعة الركيزة في اليوريا ، ويمكن إعادة تكوين عملية الانتقال بمكونات نقية في غياب أي بروتينات خلوية خلوية (Chirico et al. 1988 Matlack et al. 1999). بالإضافة إلى ذلك ، فإن نظام Hsp70 – Ydj1p مطلوب للانتقال إلى كل من ER والميتوكوندريا. وبالتالي ، من الممكن أن تحافظ مرافقات العصارة الخلوية على عديد الببتيدات فقط في شكل مطوي بشكل فضفاض وقد لا يكون لها تفاعلات محددة مع إشارات الاستهداف أو آلية الانتقال في الغشاء.

في حين أنه من المتصور أن تتفاعل ركيزة نقل ما بعد الترجمة مع نفس مرافقي عصاري خلوي مثل سلسلة عديد الببتيد المتبقية في العصارة الخلوية ، قد توجد بعض الاختلافات. بالنسبة لعديد الببتيدات التي تفتقر إلى تسلسل الإشارة ، وجد أن Hsp70 و Hsp40 (بروتين J للثدييات العصاري الخلوي) مرتبطان بسلاسل ناشئة مرتبطة بالريبوسوم (Frydman et al. 1994 Frydman and Hartl 1996 Eggers et al. 1997 Pfund et al. 1998). بالإضافة إلى ذلك ، تم الإبلاغ عن تفاعل مركب polypeptide 1 (TCP1) الذي يحتوي على الكاربونين (TRiC / CCT للمراجعة ، انظر Kim et al. 1994) مع السلاسل الوليدة المرتبطة بالريبوسوم (Frydman et al. 1994 Frydman and Hartl 1996 McCallum وآخرون ، 2000) ، على عكس المتماثل البكتيري GroEL ، الذي يربط فقط ببتيدات مكتملة (Netzer and Hartl 1998). تتفاعل أيضًا سلاسل البولي ببتيد كاملة الطول المرتبطة بالريبوسوم مع المركب المرتبط بالبولي ببتيد الناشئ (NAC) (Wiedmann et al. 1994). على الرغم من عدم إجراء دراسة منهجية حول التفاعل مع بروتينات العصارة الخلوية لركائز الانتقال بعد الترجمة ، فقد يكون الوضع مختلفًا تمامًا. أثناء تخليق سلسلة البولي ببتيد ، من المحتمل أن يتفاعل تسلسل الإشارة مع جسيم التعرف على الإشارة (SRP) ، على الرغم من أن التفاعل قد يكون أضعف من التفاعل مع سلاسل الإشارات الأكثر كارهة للماء التي توجه الركائز إلى مسار النقل المشترك (Ng et al. 1996). وبالتالي ، قد يمنع SRP ارتباط بروتينات العصارة الخلوية الأخرى بسلسلة البولي ببتيد ، خاصة طالما أنها لا تزال مرتبطة بالريبوسوم. بالإضافة إلى ذلك ، من الممكن أن تكون هناك بروتينات عصارية خلوية ، على الرغم من أنها ليست ضرورية للانتقال ، تتعرف على وجه التحديد على تسلسل الإشارة وفي مرحلة ما تحل محل SRP. بغض النظر عما إذا كان شركاء التفاعل العصاري الخلوي هم نفسهم بالنسبة لعديد الببتيدات مع أو بدون تسلسل إشارة ، فهناك مشكلة محددة تتعلق بكيفية إطلاق بروتينات العصارة الخلوية أثناء انتقال البروتين بعد الترجمة.

هنا ، استخدمنا نهجًا منهجيًا للربط بين الصور للتحقيق في تفاعلات بروتينات العصارة الخلوية مع ركائز الانتقال خلال الخطوات المبكرة لنقلها بعد الترجمة في الخميرة ، حتى ارتباطها بمجمع Sec. تشير نتائجنا إلى أن الركيزة اللاحقة للترجمة المركبة في نظام المحللة الشبكية تتفاعل مع SRP و NAC طالما أنها مرتبطة بالريبوسوم. بعد إنهاء الترجمة ، يتفاعل مع العديد من مرافقي عصاري خلوي ، بما في ذلك Hsp70 و TRiC / CCT ، وبالتالي من المحتمل أن يكون له نفس شركاء التفاعل مثل عديد ببتيد يفتقر إلى تسلسل إشارة. في الواقع ، لا يمكن اكتشاف مستقبل عصاري خلوي محدد لتسلسل إشارة ركائز ما بعد الترجمة. يحدث إطلاق بروتينات العصارة الخلوية من ركيزة الانتقال تلقائيًا ، ولا يلعب مجمع Sec أي دور نشط. بمجرد الارتباط بمركب Sec ، لا ترتبط سلسلة polypeptide بأي بروتين عصاري خلوي ، موضحًا كيف يمكن أن يحدث انتقاله اللاحق عبر قناة الغشاء دون تدخل بروتينات العصارة الخلوية.


علم الأحياء 171

بنهاية هذا القسم ، ستكون قادرًا على القيام بما يلي:

  • وصف دور الإنزيمات في مسارات التمثيل الغذائي
  • اشرح كيف تعمل الإنزيمات كمحفزات جزيئية
  • ناقش تنظيم الإنزيم حسب عوامل مختلفة

المادة التي تساعد على حدوث تفاعل كيميائي هي محفز ، والجزيئات الخاصة التي تحفز التفاعلات الكيميائية الحيوية هي إنزيمات. جميع الإنزيمات تقريبًا عبارة عن بروتينات ، تتكون من سلاسل الأحماض الأمينية ، وهي تؤدي المهمة الحاسمة المتمثلة في خفض طاقات تنشيط التفاعلات الكيميائية داخل الخلية. تقوم الإنزيمات بذلك عن طريق الارتباط بجزيئات التفاعل ، والاحتفاظ بها بطريقة تجعل عمليات تكسير الروابط الكيميائية وتشكيل الرابطة تتم بسهولة أكبر. من المهم أن نتذكر أن الإنزيمات لا تغير رد الفعل & # 8217s ∆G. بعبارة أخرى ، لا يغيرون ما إذا كان التفاعل طاردًا للطاقة (عفويًا) أو مسببًا للطاقة. هذا لأنها لا تغير المواد المتفاعلة & # 8217 أو المنتجات & # 8217 الطاقة الحرة. إنها تقلل فقط من طاقة التنشيط المطلوبة للوصول إلى الحالة الانتقالية ((الشكل)).


موقع الإنزيم النشط وخصوصية الركيزة

المتفاعلات الكيميائية التي يرتبط بها الإنزيم هي ركائز الإنزيم. قد يكون هناك ركيزة واحدة أو أكثر ، اعتمادًا على تفاعل كيميائي معين. في بعض التفاعلات ، تنقسم الركيزة أحادية التفاعل إلى نواتج متعددة. في حالات أخرى ، قد تتحد ركيزتان لتكوين جزيء أكبر. قد يدخل مفاعلان متفاعلان أيضًا في التفاعل ، حيث يتم تعديل كلاهما ، ويترك التفاعل كمنتجين. الموقع داخل الإنزيم حيث ترتبط الركيزة هو الموقع النشط للإنزيم. هذا هو المكان الذي يحدث فيه "العمل". نظرًا لأن الإنزيمات عبارة عن بروتينات ، فهناك مزيج فريد من بقايا الأحماض الأمينية (أيضًا سلاسل جانبية ، أو مجموعات R) داخل الموقع النشط. خصائص مختلفة تميز كل بقايا. يمكن أن تكون كبيرة أو صغيرة ، حمضية أو قاعدية ضعيفة ، محبة للماء أو كارهة للماء ، موجبة أو سالبة الشحنة ، أو محايدة. إن المزيج الفريد لبقايا الأحماض الأمينية ، ومواضعها ، وتسلسلها ، وبنيتها ، وخصائصها ، يخلق بيئة كيميائية محددة للغاية داخل الموقع النشط. هذه البيئة المحددة مناسبة للارتباط ، وإن كان لفترة وجيزة ، بركيزة كيميائية معينة (أو ركائز). بسبب هذه المباراة الشبيهة بأحجية الصور المقطوعة بين الإنزيم وركائزه (التي تتكيف لإيجاد أفضل ملاءمة بين حالة الانتقال والموقع النشط) ، تُعرف الإنزيمات بخصوصية كل منها. ينتج "أفضل ملاءمة" عن جاذبية الشكل والمجموعة الوظيفية للأحماض الأمينية إلى الركيزة. يوجد إنزيم مطابق بشكل خاص لكل ركيزة ، وبالتالي ، لكل تفاعل كيميائي ، هناك مرونة أيضًا.

حقيقة أن المواقع النشطة مناسبة تمامًا لتوفير ظروف بيئية محددة تعني أيضًا أنها تخضع لتأثيرات بيئية محلية. صحيح أن زيادة درجة حرارة البيئة تزيد بشكل عام من معدلات التفاعل ، المحفز بالإنزيم أو غير ذلك. ومع ذلك ، فإن زيادة أو خفض درجة الحرارة خارج النطاق الأمثل يمكن أن يؤثر على الروابط الكيميائية داخل الموقع النشط بطريقة تجعلها أقل ملاءمة لربط الركائز. ستؤدي درجات الحرارة المرتفعة في النهاية إلى إفساد الإنزيمات ، مثل الجزيئات البيولوجية الأخرى ، وهي عملية تغير الخصائص الطبيعية للمادة. وبالمثل ، يمكن أن تؤثر البيئة المحلية & # 8217 s أيضًا على وظيفة الإنزيم. بقايا الأحماض الأمينية في الموقع النشط لها خصائصها الحمضية أو الأساسية الخاصة بها والتي تعتبر مثالية للحفز. هذه البقايا حساسة للتغيرات في الأس الهيدروجيني التي يمكن أن تضعف الطريقة التي ترتبط بها جزيئات الركيزة. الأنزيمات مناسبة للعمل بشكل أفضل ضمن نطاق معين من الأس الهيدروجيني ، وكما هو الحال مع درجة الحرارة ، يمكن أن تتسبب قيم الأس الهيدروجيني البيئية المتطرفة (الحمضية أو القاعدية) في إفساد طبيعة الإنزيمات.

وظيفة الانزيم واللياقة المستحثة

لسنوات عديدة ، اعتقد العلماء أن ارتباط الركيزة الإنزيمية يحدث بطريقة "القفل والمفتاح" البسيطة. أكد هذا النموذج أن الإنزيم والركيزة يتناسبان معًا تمامًا في خطوة لحظية واحدة. ومع ذلك ، يدعم البحث الحالي وجهة نظر أكثر دقة يسميها العلماء الملاءمة المستحثة ((الشكل)). يتوسع هذا النموذج في نموذج القفل والمفتاح من خلال وصف تفاعل أكثر ديناميكية بين الإنزيم والركيزة. عندما يجتمع الإنزيم والركيزة معًا ، يتسبب تفاعلهما في حدوث تحول طفيف في بنية الإنزيم الذي يؤكد ترتيب ارتباط مثالي بين الإنزيم وحالة انتقال الركيزة & # 8217s. يزيد هذا الارتباط المثالي من قدرة الإنزيم على تحفيز تفاعله.

عندما يربط الإنزيم ركائزه ، فإنه يشكل مركب ركيزة إنزيم. يقلل هذا المركب من رد الفعل وطاقة التنشيط # 8217s ويعزز تقدمه السريع بإحدى الطرق العديدة. على المستوى الأساسي ، تعزز الإنزيمات التفاعلات الكيميائية التي تنطوي على أكثر من ركيزة واحدة عن طريق تجميع الركائز معًا في الاتجاه الأمثل. يتم وضع المنطقة المناسبة (الذرات والسندات) لجزيء واحد جنبًا إلى جنب مع الجزيء الآخر والمنطقة المناسبة التي يجب أن يتفاعل معها الجزيء. هناك طريقة أخرى تعزز بها الإنزيمات تفاعل الركيزة وهي خلق بيئة مثالية داخل الموقع النشط لحدوث التفاعل. قد تحدث تفاعلات كيميائية معينة بشكل أفضل في بيئة حمضية قليلاً أو بيئة غير قطبية. الخصائص الكيميائية التي تظهر من الترتيب الخاص لبقايا الأحماض الأمينية داخل موقع نشط تخلق بيئة مثالية لتفاعل ركائز الإنزيم المحددة.

لقد تعلمت أن طاقة التنشيط المطلوبة للعديد من التفاعلات تتضمن الطاقة المستخدمة في معالجة الروابط الكيميائية أو تشويهها قليلاً بحيث يمكن كسرها بسهولة والسماح للآخرين بالتعافي. يمكن أن يساعد العمل الأنزيمي في هذه العملية. يمكن لمركب الركيزة الإنزيمية خفض طاقة التنشيط عن طريق تشويه جزيئات الركيزة بطريقة تسهل كسر الرابطة ، مما يساعد على الوصول إلى حالة الانتقال. أخيرًا ، يمكن للإنزيمات أيضًا تقليل طاقات التنشيط من خلال المشاركة في التفاعل الكيميائي نفسه. يمكن أن توفر بقايا الأحماض الأمينية أيونات معينة أو مجموعات كيميائية تشكل في الواقع روابط تساهمية مع جزيئات الركيزة كخطوة ضرورية في عملية التفاعل. في هذه الحالات ، من المهم أن تتذكر أن الإنزيم سيعود دائمًا إلى حالته الأصلية عند اكتمال التفاعل & # 8217s. أحد الإنزيمات & # 8217 الخواص المميزة هي أنها تظل دون تغيير في النهاية من خلال التفاعلات التي تحفزها. بعد أن يحفز الإنزيم التفاعل ، فإنه يطلق منتجه (منتجاته).


التحكم في التمثيل الغذائي من خلال تنظيم الإنزيم

قد يبدو من المثالي أن يكون لديك سيناريو تتواجد فيه جميع الإنزيمات المشفرة في جينوم الكائن الحي في إمداد وفير وتعمل على النحو الأمثل في جميع الظروف الخلوية ، في جميع الخلايا ، في جميع الأوقات. في الواقع ، هذا بعيد كل البعد عن الواقع. تضمن مجموعة متنوعة من الآليات عدم حدوث ذلك. تختلف الاحتياجات والظروف الخلوية من خلية إلى أخرى ، وتتغير داخل الخلايا الفردية بمرور الوقت. تختلف متطلبات الطاقة والإنزيمات المطلوبة لخلايا المعدة عن تلك الموجودة في خلايا تخزين الدهون وخلايا الجلد وخلايا الدم والخلايا العصبية. علاوة على ذلك ، تعمل الخلية الهضمية بشكل أكثر صعوبة في معالجة العناصر الغذائية وتفكيكها خلال الوقت الذي يتبع الوجبة عن كثب مقارنة بساعات عديدة بعد الوجبة. نظرًا لاختلاف هذه المتطلبات والظروف الخلوية ، تختلف أيضًا كميات ووظائف الإنزيمات المختلفة.

نظرًا لأن معدلات التفاعلات الكيميائية الحيوية يتم التحكم فيها بواسطة طاقة التنشيط ، وتنخفض الإنزيمات وتحدد طاقات التنشيط للتفاعلات الكيميائية ، فإن الكميات النسبية وعمل مجموعة متنوعة من الإنزيمات داخل الخلية تحدد في النهاية التفاعلات التي ستستمر وبأي معدلات. يتم التحكم في هذا التحديد بإحكام. في بعض البيئات الخلوية ، تتحكم العوامل البيئية مثل درجة الحموضة ودرجة الحرارة جزئيًا في نشاط الإنزيم.هناك آليات أخرى تتحكم من خلالها الخلايا في نشاط الإنزيم وتحدد المعدلات التي تحدث بها تفاعلات كيميائية حيوية مختلفة.

التنظيم الجزيئي للإنزيمات

يمكن تنظيم الإنزيمات بطرق إما تعزز أو تقلل من نشاطها. هناك العديد من الأنواع المختلفة للجزيئات التي تثبط أو تعزز وظيفة الإنزيم ، وتوجد آليات مختلفة للقيام بذلك. على سبيل المثال ، في بعض حالات تثبيط الإنزيم ، يكون جزيء المثبط مشابهًا بدرجة كافية للركيزة التي يمكنها الارتباط بالموقع النشط ومنع الركيزة ببساطة من الارتباط. عندما يحدث هذا ، يتم تثبيط الإنزيم من خلال التثبيط التنافسي ، لأن جزيء المثبط يتنافس مع الركيزة لربط الموقع النشط ((الشكل)). بدلاً من ذلك ، في التثبيط غير التنافسي ، يرتبط جزيء المثبط بالإنزيم في مكان آخر غير موقع التباين ، وهو موقع ربط بعيدًا عن الموقع النشط ، ولا يزال قادرًا على منع ارتباط الركيزة بالموقع النشط.


ترتبط بعض جزيئات المثبط بالأنزيمات في مكان يؤدي فيه ارتباطها إلى إحداث تغيير توافقي يقلل من تقارب الإنزيم & # 8217s لركائزه. هذا النوع من التثبيط هو تثبيط خيفي ((الشكل)). يشتمل أكثر من عديد ببتيد واحد على معظم الإنزيمات المنظمة بشكل خيفي ، مما يعني أن لديهم أكثر من وحدة بروتينية فرعية. عندما يرتبط مثبط خيفي بإنزيم ، تتغير جميع المواقع النشطة في الوحدات الفرعية للبروتين بشكل طفيف بحيث تربط ركائزها بكفاءة أقل. هناك المنشطات الخيفية وكذلك مثبطات. ترتبط المنشطات الخيفية بالمواقع الموجودة على إنزيم بعيدًا عن الموقع النشط ، مما يؤدي إلى تغيير توافقي يزيد من تقارب موقع (مواقع) الإنزيم النشط مع ركائزه (ركائزه).



اكتشاف الأدوية عن طريق البحث عن مثبطات الإنزيمات الرئيسية في مسارات محددة إن الإنزيمات هي المكونات الرئيسية لمسارات التمثيل الغذائي. إن فهم كيفية عمل الإنزيمات وكيف يمكن تنظيمها هو مبدأ أساسي وراء تطوير العديد من الأدوية الصيدلانية ((الشكل)) في السوق اليوم. يتعاون علماء الأحياء العاملون في هذا المجال مع علماء آخرين ، عادة كيميائيين ، لتصميم الأدوية.

ضع في اعتبارك العقاقير المخفضة للكوليسترول على سبيل المثال - وهي فئة من الأدوية تقلل مستويات الكوليسترول. هذه المركبات هي في الأساس مثبطات لإنزيم اختزال HMG-CoA. اختزال HMG-CoA هو الإنزيم الذي يصنع الكوليسترول من الدهون في الجسم. عن طريق تثبيط هذا الإنزيم ، يقلل الدواء من مستويات الكوليسترول المركب في الجسم. وبالمثل ، فإن عقار الأسيتامينوفين ، الذي يتم تسويقه بشكل شائع تحت الاسم التجاري تايلينول ، هو مثبط لإنزيم إنزيم الأكسدة الحلقية. في حين أنه فعال في توفير الراحة من الحمى والالتهاب (الألم) ، لا يزال العلماء لا يفهمون تمامًا آلية عمله.

كيف يتم تطوير الأدوية؟ يتمثل أحد التحديات الأولى في تطوير الدواء في تحديد الجزيء المحدد الذي يهدف الدواء إلى استهدافه. في حالة الستاتينات ، فإن اختزال HMG-CoA هو الهدف الدوائي. يحدد الباحثون الأهداف من خلال البحث المضني في المختبر. تحديد الهدف وحده لا يكفي. يحتاج العلماء أيضًا إلى معرفة كيفية عمل الهدف داخل الخلية وأي تفاعلات تنحرف في حالة المرض. بمجرد أن يحدد الباحثون الهدف والمسار ، تبدأ عملية تصميم الدواء الفعلية. خلال هذه المرحلة ، يعمل الكيميائيون وعلماء الأحياء معًا لتصميم وتوليف الجزيئات التي يمكنها إما منع تفاعل معين أو تنشيطه. ومع ذلك ، فهذه ليست سوى البداية: إذا وعندما نجح نموذج أولي للدواء في أداء وظيفته ، فيجب أن يخضع للعديد من الاختبارات من في المختبر إجراء التجارب على التجارب السريرية قبل أن تتمكن من الحصول على موافقة إدارة الغذاء والدواء (FDA) ليتم طرحها في السوق.

العديد من الإنزيمات لا تعمل على النحو الأمثل ، أو حتى على الإطلاق ، ما لم ترتبط بجزيئات مساعدة معينة غير بروتينية ، إما مؤقتًا من خلال الروابط الأيونية أو الهيدروجينية أو بشكل دائم من خلال روابط تساهمية أقوى. نوعان من الجزيئات المساعدة هما العوامل المساعدة والإنزيمات المساعدة. يعزز الارتباط بهذه الجزيئات التشكل والوظيفة الأمثل لأنزيمات كل منها. العوامل المساعدة هي أيونات غير عضوية مثل الحديد (Fe ++) والمغنيسيوم (Mg ++). أحد الأمثلة على الإنزيم الذي يتطلب أيون معدني كعامل مساعد هو الإنزيم الذي يبني جزيئات DNA ، DNA polymerase ، الذي يتطلب وجود أيون زنك مرتبط (Zn ++) ليعمل. الإنزيمات المساعدة هي جزيئات عضوية مساعدة ، ذات بنية ذرية أساسية تتكون من الكربون والهيدروجين ، وهي ضرورية لعمل الإنزيم. المصادر الأكثر شيوعًا للأنزيمات المساعدة هي الفيتامينات الغذائية ((الشكل)). بعض الفيتامينات هي مقدمة للإنزيمات المساعدة والبعض الآخر يعمل مباشرة مثل الإنزيمات المساعدة. فيتامين سي هو أنزيم للعديد من الإنزيمات التي تشارك في بناء عنصر النسيج الضام المهم ، وهو الكولاجين. خطوة مهمة في تكسير الجلوكوز لإنتاج الطاقة هي التحفيز بواسطة مركب متعدد الإنزيمات يطلق عليه العلماء بيروفات ديهيدروجينيز. Pyruvate dehydrogenase عبارة عن مركب من عدة إنزيمات تتطلب في الواقع عاملًا مساعدًا واحدًا (أيون المغنيسيوم) وخمسة أنزيمات عضوية مختلفة لتحفيز تفاعلها الكيميائي المحدد. لذلك ، يتم تنظيم وظيفة الإنزيم ، جزئيًا ، من خلال وفرة من العوامل المساعدة والأنزيمات المساعدة المختلفة ، التي توفرها الأنظمة الغذائية لمعظم الكائنات الحية.


تجزئة الإنزيم

في الخلايا حقيقية النواة ، عادة ما يتم تجزئة الجزيئات مثل الإنزيمات إلى عضيات مختلفة. هذا يسمح لمستوى آخر من تنظيم نشاط الإنزيم. أحيانًا يتم وضع الإنزيمات المطلوبة فقط لعمليات خلوية معينة بشكل منفصل مع ركائزها ، مما يسمح بتفاعلات كيميائية أكثر كفاءة. تتضمن الأمثلة على هذا النوع من تنظيم الإنزيم بناءً على الموقع والقرب الإنزيمات المشاركة في المراحل الأخيرة من التنفس الخلوي ، والتي تحدث حصريًا في الميتوكوندريا ، والإنزيمات المشاركة في هضم الحطام الخلوي والمواد الغريبة الموجودة داخل الجسيمات الحالة.

تثبيط ردود الفعل في المسارات الأيضية

يمكن للجزيئات تنظيم وظيفة الإنزيم بعدة طرق. ومع ذلك ، يبقى سؤال رئيسي: ما هي هذه الجزيئات ومن أين تأتي؟ بعضها عبارة عن عوامل مساعدة وأنزيمات مساعدة وأيونات وجزيئات عضوية ، كما تعلمت. ما هي الجزيئات الأخرى في الخلية التي توفر تنظيمًا إنزيميًا ، مثل التعديل الخيفي والتثبيط التنافسي وغير التنافسي؟ الجواب هو أن مجموعة متنوعة من الجزيئات يمكنها أداء هذه الأدوار. يشمل بعضها الأدوية الصيدلانية وغير الصيدلانية والسموم والسموم من البيئة. ربما تكون أهم مصادر الجزيئات المنظمة للإنزيم ، فيما يتعلق بالاستقلاب الخلوي ، هي منتجات التفاعل الأيضي الخلوي نفسها. بأكثر الطرق فاعلية وأناقة ، تطورت الخلايا لاستخدام ردود أفعالها الخاصة & # 8217 المنتجات لتثبيط ردود الفعل من نشاط الإنزيم. يتضمن منع التغذية الراجعة استخدام منتج رد الفعل لتنظيم إنتاجه الإضافي ((الشكل)). تستجيب الخلية لوفرة منتجات معينة عن طريق إبطاء الإنتاج أثناء التفاعلات الابتنائية أو التقويضية. قد تثبط منتجات التفاعل هذه الإنزيمات التي حفزت إنتاجها من خلال الآليات التي وصفناها أعلاه.


يتم التحكم في إنتاج كل من الأحماض الأمينية والنيوكليوتيدات من خلال تثبيط التغذية الراجعة. بالإضافة إلى ذلك ، ATP هو منظم خيفي لبعض الإنزيمات المشاركة في انهيار تقويضي السكر # 8217s ، العملية التي تنتج ATP. بهذه الطريقة ، عندما تكون ATP وفيرة ، يمكن للخلية أن تمنع إنتاجها الإضافي. تذكر أن ATP هو جزيء غير مستقر يمكن أن ينفصل تلقائيًا إلى ADP. إذا كان الكثير من ATP موجودًا في الخلية ، فسيتم إهدار الكثير منه. بدلاً من ذلك ، يعمل ADP كمنظم خيفي إيجابي (منشط خيفي) لبعض الإنزيمات نفسها التي تثبطها ATP. وبالتالي ، عندما تكون مستويات ATP النسبية مرتفعة مقارنة بـ ATP ، يتم تشغيل الخلية لإنتاج المزيد من ATP من خلال هدم السكر.

ملخص القسم

الإنزيمات عبارة عن محفزات كيميائية تعمل على تسريع التفاعلات الكيميائية في درجات الحرارة الفسيولوجية عن طريق خفض طاقة التنشيط. عادة ما تكون الإنزيمات عبارة عن بروتينات تتكون من واحد أو أكثر من سلاسل عديد الببتيد. تحتوي الإنزيمات على موقع نشط يوفر بيئة كيميائية فريدة تتكون من مجموعات معينة من الأحماض الأمينية R (بقايا). هذه البيئة الفريدة مناسبة تمامًا لتحويل مفاعلات كيميائية معينة لهذا الإنزيم ، كما يسميها العلماء الركائز ، إلى مواد وسيطة غير مستقرة يسمونها حالات الانتقال. ترتبط الإنزيمات والركائز بتوافق مستحث ، مما يعني أن الإنزيمات تخضع لتعديلات طفيفة عند ملامسة الركيزة ، مما يؤدي إلى ارتباط كامل ومثالي. ترتبط الإنزيمات بالركائز وتحفز التفاعلات بأربع طرق مختلفة: تجميع الركائز معًا في الاتجاه الأمثل ، مما يؤدي إلى تعريض هياكل الروابط للركائز للخطر بحيث يمكن أن تتفكك الروابط بسهولة أكبر ، مما يوفر الظروف البيئية المثلى لحدوث رد فعل ، أو المشاركة مباشرة في تفاعل كيميائي عن طريق تكوين روابط تساهمية عابرة مع الركائز.

يجب تنظيم عمل الإنزيم بحيث يتم تحفيز التفاعلات المرغوبة في خلية معينة في وقت معين ولا يتم تحفيز التفاعلات غير المرغوب فيها. يتم تنظيم الإنزيمات حسب الظروف الخلوية ، مثل درجة الحرارة ودرجة الحموضة. يتم تنظيمها أيضًا من خلال موقعها داخل خلية ، وفي بعض الأحيان يتم تجزئتها بحيث لا يمكنها تحفيز التفاعلات إلا في ظل ظروف معينة. يعد تثبيط الإنزيم وتنشيطه عبر جزيئات أخرى طرقًا مهمة أخرى لتنظيم الإنزيمات. يمكن للمثبطات أن تتصرف بشكل تنافسي أو غير تنافسي أو غير تنافسي. عادة ما تكون مثبطات غير تنافسية خيفي. يمكن للمنشطات أيضًا تعزيز وظيفة الإنزيم بشكل خيفي. الطريقة الأكثر شيوعًا التي تنظم بها الخلايا الإنزيمات في المسارات الأيضية هي من خلال تثبيط التغذية الراجعة. أثناء تثبيط التغذية الراجعة ، تعمل منتجات المسار الأيضي كمثبطات (عادة خيفي) لواحد أو أكثر من الإنزيمات (عادةً أول إنزيم ملتزم بالمسار) يشارك في المسار الذي ينتجها.

إستجابة مجانية

فيما يتعلق بالإنزيمات ، لماذا الفيتامينات ضرورية لصحة جيدة؟ أعط أمثلة.

تعمل معظم الفيتامينات والمعادن كأنزيمات مساعدة وعوامل مساعدة لعمل الإنزيم. تتطلب العديد من الإنزيمات ارتباط بعض العوامل المساعدة أو الإنزيمات المساعدة لتحفيز تفاعلاتها. نظرًا لأن الإنزيمات تحفز العديد من التفاعلات المهمة ، فمن الأهمية بمكان الحصول على الفيتامينات والمعادن الكافية من النظام الغذائي ومن المكملات الغذائية. فيتامين ج (حمض الأسكوربيك) هو أنزيم ضروري لعمل الإنزيمات التي تبني الكولاجين ، وهو مكون بروتيني مهم للنسيج الضام في جميع أنحاء الجسم. أيون المغنيسيوم (Mg ++) هو عامل مساعد مهم ضروري لأنزيم البيروفات ديهيدروجينيز لتحفيز جزء من المسار الذي يكسر السكر لإنتاج الطاقة. لا يمكن إنتاج الفيتامينات في جسم الإنسان ولذلك يجب الحصول عليها في النظام الغذائي.

اشرح بأسلوبك الخاص كيف أن تثبيط التغذية الراجعة للإنزيم يفيد الخلية.

يسمح تثبيط التغذية المرتدة للخلايا بالتحكم في كميات المنتجات الأيضية المنتجة. إذا كان هناك الكثير من منتج معين بالنسبة لاحتياجات الخلية ، فإن تثبيط التغذية الراجعة يؤدي بشكل فعال إلى تقليل الخلية لإنتاج هذا المنتج المعين. بشكل عام ، هذا يقلل من إنتاج المنتجات غير الضرورية ويحفظ الطاقة ، ويزيد من كفاءة الطاقة.

قائمة المصطلحات


مناقشة

على حد علمنا ، نقدم أول دليل مباشر على تعاون Cdc48 و 26S proteasome في تحطيم البروتينات المدمجة والمطوية جيدًا ، حيث يؤدي التفكك بواسطة Cdc48 إلى إنشاء مناطق بدء مرنة تمكن من المعالجة الأولية اللاحقة. تحدد عملية إعادة التكوين لدينا Cdc48 • UN و holoenzyme البروتياز كمكونات الحد الأدنى المطلوب لهذا التدهور المقترن ، بغض النظر عن مستقبلات المكوك مثل Rad23 أو Otu1 deubiquitinase. يبدو أن سلاسل يوبيكويتين القصيرة والمتفرعة نسبيًا على ركائز نموذجنا تتكشف وتشترك في نقل مواضعها بواسطة Cdc48 ، وقد تنعكس بعد ذلك بسرعة أكبر من الركيزة نفسها ، مما يسمح بربط مستقبلات اليوبيكويتين بينما يمكن للمنطقة غير المهيكلة من مادة البولي ببتيد الركيزة أن تتفاعل مع محرك ATPase للبروتوزوم. ومن المثير للاهتمام ، أن معظم تعديلات البولي يوبيكويتين على البروتينات في محللة الخميرة القابلة للذوبان تشتمل على ما يصل إلى سبعة شقوق يوبيكويتين 32 ، والتي وفقًا لنتائجنا السابقة 19 يجب أن تسمح بالانتقال الكامل بواسطة Cdc48 دون الحاجة إلى إزالة التكوُّن بواسطة Otu1.

لقد صممنا الركيزة المنتشرة بحيث تفتقر إلى أي روابط أو طرف مرن ، ولا يزال من غير الواضح أين يبدأ Cdc48 في الظهور. اقترحت الدراسات الهيكلية الحديثة أن مهايئ الأمم المتحدة يضع ubiquitin بالقرب من المسام المركزي لـ Cdc48 ، بحيث قد يبدأ الانكشاف على جزء من جزء ubiquitin القريب ، والذي من شأنه أن يشكل موقع بدء عالمي للانتقال بغض النظر عن الركيزة المرفقة بولي ببتيد 19. نستنتج استنادًا إلى النتائج التي توصلنا إليها أن التفكك الأولي يجب أن يتم تسهيله من خلال مجالات D1 و / أو مجالات N-terminal في Cdc48. يتطلب التفتح والترابط فقط من خلال مجالات D2 ، كما هو مقترح سابقًا ، أن تحتوي الركيزة على منطقة بدء مرنة بطول مماثل لتلك الخاصة بالمشاركة الأولية ، وهذا ليس هو الحال بوضوح.

بعد الكشف الكامل ، من المحتمل أن يتم إطلاق الركيزة بواسطة Cdc48 وتنتشر إلى البروتيازوم 26S ، ولكن يمكن للدراسات المستقبلية أن تتناول ما إذا كان أي تفاعل مباشر بين هذه الآلات الجزيئية يحدث لتسليم الركيزة. في حين أن التفاعلات المتنافسة في ظل ظروفنا التجريبية حالت دون قياس السرعة القصوى للتدهور البروتيني المقترن بـ Cdc48 ، فمن المتوقع أن يتم تسهيل نقل الركيزة في الجسم الحي من خلال التفاعلات مع مستقبلات المكوك Rad23 و Dsk2 ، مما قد يؤدي إلى استقرار الحالة غير المكشوفة للركائز وزيادة تقاربها للبروتيسوم 33،34،35. علاوة على ذلك ، قد يقوم كل من deubiquitinase Otu1 المرتبط بـ Cdc48 و E4 ligase Ufd2 بتحرير وتمديد تعديلات يوبيكويتين المرتبطة بالركيزة في Cdc48 لتعزيز الارتباط بالبروتيازوم وتقييد إعادة الارتباط المتنافس مع محولات Cdc48.

يشارك Cdc48 في عدد لا يحصى من العمليات ، ولا يؤدي كل نشاطه المتكشف إلى التدهور. يتيح نظامنا المعاد تكوينه إجراء تحقيقات مستقبلية مهمة حول كيفية تحديد Cdc48 والبروتيازوم لمصير البروتين ، وكيفية التعرف على تعديلات يوبيكويتين المختلفة بواسطة محولات Cdc48 والبروتوزوم ، وكيف يمكن تحرير هذه التعديلات بواسطة Otu1 و Ufd2 لتعديل معالجة الركيزة وتحديدها ترتيب التفاعلات مع هذه الآلات الجزيئية.


مناقشة

وجدنا في الدراسة الحالية أن التقسيم الانتصافي الثاني لبيض الفأر كان مرتبطًا بفترة تدمير البروتينات التي تحتوي إما على شكل D- أو KEN-box ، بما يتوافق مع نشاط كل من APC cdc20 و APC cdh1 عند الإخصاب. بعد التلقيح ، تسببت سلسلة من طفرات Ca 2+ التي تسببها الحيوانات المنوية في تدمير كل من سيكورين وسيكلين B1 في البيض. اكتمل تدميرها بحلول الوقت الذي انخفض فيه نشاط CDK1 وتم قذف الجسم القطبي الثاني. نظرًا لأن كلا من cyclin B1 و securin يحتويان على مربع D ، فمن المحتمل أن يكون هذا التدهور بسبب APC cdc20 و / أو APC cdh1. ومع ذلك ، في بيض MII ، لاحظنا أن بروتين cdh1 قد تمت فسفرته ، وهو ما يمنعه في الخلايا الانقسامية من الارتباط بـ APC / C. تم تأكيد عدم قدرة cdh1 على تنشيط APC / C في MII مباشرة باستخدام ركائز APC cdh1 التي لم يتم التعرف عليها بواسطة APC cdc20. وهكذا استخدمنا cdc20 نفسه وشكلًا متحورًا من مربع D من سيكورين يحتوي كلاهما على صندوق KEN ، لتوليد بروتينات الانصهار GFP التي كانت ركائز لـ APC cdh1. كان كل من هذين التركيبين مستقرين في البداية في البويضات المخصبة ، لكن تدهورهما بدأ فجأة بعد 1-2 ساعة من تحفيز الحيوانات المنوية Ca 2+ spiking ، في وقت قذف الجسم القطبي. استمر تدهورها حتى اكتمل الانقسام الاختزالي الثاني وتشكلت النواة في جنين خلية واحدة. لذلك لم يكن هناك تنشيط فوري لـ APC cdh1 عند الإخصاب ، وبدلاً من ذلك بدا أن هناك تحولًا من نشاط APC cdc20 إلى نشاط APC cdh1 في وقت بثق الجسم القطبي الثاني (هذا موضح في الشكل 8). بدت جميع ركائز APC / C مستقرة بعد تكوين النواة.

نموذج تنشيط APC cdc20 و APC cdh1 أثناء الانقسام الاختزالي II. البيض غير المخصب MII ، والذي يحتوي على مستويات عالية من CDK1 ، لديه نشاط منخفض لـ APC cdc20 و APC cdh1. تبدأ إشارة Ca 2+ المشتقة من الحيوانات المنوية تنشيط APC cdc20 عند اندماج الأمشاج ، وهو المسؤول عن تدهور cyclin B1 / securin والخسارة المرتبطة به في نشاط CDK1. يسمح تدهور ركائز APC cdc20 بتشكيل الجسم القطبي الثاني وفي هذا الوقت يظهر نشاط APC cdh1. APC cdh1 مسؤول عن تدهور ركائز KEN-box مثل cdc20. ينخفض ​​نشاط APC cdh1 عندما يتشكل النوى ويدخل الزيجوت في المرحلة S من دورة الخلية الجنينية الأولى.

نموذج تنشيط APC cdc20 و APC cdh1 أثناء الانقسام الاختزالي II. البيض غير المخصب MII ، والذي يحتوي على مستويات عالية من CDK1 ، لديه نشاط منخفض لـ APC cdc20 و APC cdh1. تبدأ إشارة Ca 2+ المشتقة من الحيوانات المنوية تنشيط APC cdc20 عند اندماج الأمشاج ، وهو المسؤول عن تدهور cyclin B1 / securin والخسارة المرتبطة به في نشاط CDK1. يسمح تدهور ركائز APC cdc20 بتشكيل الجسم القطبي الثاني وفي هذا الوقت يظهر نشاط APC cdh1. APC cdh1 مسؤول عن تدهور ركائز KEN-box مثل cdc20. ينخفض ​​نشاط APC cdh1 عندما يتشكل النوى ويدخل الزيجوت في المرحلة S من دورة الخلية الجنينية الأولى.

تفعيل APC cdc20 بواسطة Ca 2+

يطلق الحيوانات المنوية سلسلة طويلة الأمد من نوبات الكالسيوم 2+ عن طريق إطلاق عضو خاص بالحيوانات المنوية في البويضة من عائلة فسفوليباز C (PLC) ، PLCζ (Saunders et al. ، 2002). يرفع هذا PLC البيضص3 مستويات ، مما أدى إلى قطار من Ca 2+ spikes (Jones and Nixon ، 2000). Ca 2+ spiking ، في عملية يتوسطها بروتين كيناز 2 المعتمد على الهدودولين (Markoulaki et al. ، 2003 Markoulaki et al. ، 2004) ، هو الدافع الضروري والكافي لاستئناف الانقسام الاختزالي بعد توقيف MII (Hyslop et al. ، 2004). يبدأ التحلل البروتيني المعتمد على D-box لـ cyclin B1 (Nixon et al. ، 2002) و securin (البيانات الحالية) في نفس الوقت بعد بضع دقائق فقط من أول Ca 2+ spike. نحن نفسر هذا على أنه يعني أن تنشيط E3 ligase APC cdc20 يحدث بعد وقت قصير من بدء الارتفاعات بنفس الطريقة التي أظهر بها APC cdc20 أنه قيد التشغيل وضروري أثناء تنشيط بيض الضفدع (Lorca et al. ، 1998). ومع ذلك ، فإن بيض الفأر يعبر أيضًا عن RFLP4 ، وهو E3 ligase الذي تشتمل ركائزه على cyclin B1 (Suzumori et al. ، 2003) والذي قد يؤدي نفس الوظيفة مثل APC cdc20 بالفعل تم وصف متغيرات الانقسام الاختزالي الجديدة لـ cdc20 في الخميرة (Cooper et al. ، 2000) و ذبابة الفاكهة (تشو وآخرون ، 2001). لا تستبعد البيانات الحالية وظيفة RFLP4 في الانقسام الاختزالي بالماوس.ومع ذلك ، نظهر هنا أن بيض الفأر يحتوي بالفعل على cdc20 ، وقد أظهرنا سابقًا أنه يمكن منع استئناف دورة الخلية بوساطة Ca 2+ وتدهور cyclin B1 عن طريق تحريض نقطة تفتيش المغزل (Jones et al. ، 1995 Nixon et al. ، 2002). هذا من شأنه أن يدعم دور APC cdc20 لأن تنشيط نقطة تفتيش المغزل هو مثبط قوي لنشاط APC cdc20 (Yu ، 2002). يتم التوسط في هذا التأثير بواسطة mad2 ، أحد بروتينات نقطة تفتيش المغزل ، والتي ترتبط بشكل خاص ومباشر بـ cdc20 (Luo et al. ، 2000). لذلك ، من المحتمل أن يكون لـ RFLP4 دور محدد أثناء الانقسام الاختزالي الأول ، أو يساهم بدلاً من ذلك في تدهور سيكورين / سيكلين B1 أثناء الانقسام الاختزالي الثاني ، بمجرد تنشيط APC / C.

في مزيد من الدعم لـ APC cdc20 التي لها دور خلال الانقسام الاختزالي II ، كانت الملاحظة أن الركائز المحتوية على D-box و KEN-box مستهدفة لتحلل البروتين عندما ينخفض ​​نشاط CDK1 عند بثق الجسم القطبي الثاني. هذا يعني التبديل من نشاط APC cdc20 إلى نشاط APC cdh1 في هذا الوقت. لا يحدث هذا التبديل في بيض الضفادع الذي يفتقر إلى بروتين cdh1 ، ولكن توقيت هذا التبديل سيكون متسقًا مع ذلك الذي تم الإبلاغ عنه من الدراسات الانقسامية في خلايا الثدييات (Hagting et al. ، 2002 Zur and Brandeis ، 2002) والتنظيم السلبي لـ cdh1 بواسطة MPF.

في هذا الوقت ، من غير المعروف كيف يؤدي تنشيط Ca 2+ لبروتين كيناز II المعتمد على الكالودولين إلى تشغيل APC cdc20. تاريخيًا ، استُخدم مصطلح "عامل تثبيط الخلايا" لوصف النشاط في البيض المسؤول عن توقيف MII. من المحتمل أن يشكل نشاط عامل تثبيط الخلايا قمعًا لنشاط APC cdc20. في الواقع ، فإن بعض المرشحين الذين لديهم نشاط عامل تثبيط الخلايا هم مثبطات لـ APC cdc20. يتضمن ذلك Emi1 ، الذي يربط cdc20 وبذلك يمنع cdc20 من ربط APC / C (Reimann and Jackson ، 2002) ، ومكونات مختلفة لنقطة فحص المغزل (Schwab et al. ، 2001 Tunquist et al. ، 2003).

لماذا بعض البيض يحتوي على cdh1 والبعض الآخر لا

هناك حاجة إلى مزيد من الدراسات لتحديد كل من وظيفة وتنظيم APC cdh1 أثناء الانقسام الاختزالي للماوس II ، بالإضافة إلى ذلك ، نظرًا لأننا لاحظنا وجودها في جميع مراحل نضج البويضات ، فإن دورها في الانقسام الانتصافي الأول. من الممكن أن يتم إيقاف تشغيل APC cdh1 للفأر أثناء الانقسام الاختزالي I ، حيث أنه عن طريق القياس في الخميرة الناشئة ، يمنع مثبط خاص بالانقسام الاختزالي لـ cdh1 نشاط APC cdh1 أثناء التقسيم الانتصافي الأول (Bolte et al. ، 2002). يشير العمل الحالي إلى دور نشاط CDK1 في تنظيم APC cdh1 أثناء الانقسام الاختزالي II ، ولكن لا يُعرف أي شيء عن دور الفوسفاتيز cdc14 ، وهو أمر ضروري لتنشيط cdh1 ، في بيض الفئران. وبالتالي يجب أن تتناول الدراسات المستقبلية كيفية تنظيم cdh1 بواسطة CDK1 / cdc14 خلال التقسيمين الانتصائيين ، اللذين يتم فصلهما مؤقتًا بساعات قليلة فقط. في الانقسام الانقسامي ، يبدو أن نشاط cdh1 يمكن الاستغناء عنه بسهولة ، بحيث لا يزال بإمكان الخلايا الخروج من الانقسام في غياب cdh1. لذلك من الممكن الاستغناء عن cdh1 لعملية إكمال الانقسام الاختزالي II. ومع ذلك ، فقد وجد أن APC cdh1 لها وظائف محددة لاحقًا في دورة الخلية في G1 ، فهي مسؤولة عن جعل نقطة تفتيش G1-S مسموحًا بها (Sudo et al. ، 2001) ومنع الدخول المبكر إلى المرحلة S (Bashir et al. ، 2004 Wei et al.، 2004). يبدو أيضًا أن APC cdh1 لها وظائف خارج دورة الخلية ، كما هو الحال في الخلايا العصبية بعد الانقسام الخيطي حيث تنظم نمو المحاور (كونيشي وآخرون ، 2004) وفي بعض الدراسات وجد أن وجودها مرتبط ببدء تمايز الخلايا (بلانكو وآخرون ، 2000). لذلك سيكون من المثير للاهتمام تحديد الدور الذي يلعبه cdh1 الأمومي في الأجنة حتى تنشيط الجينوم اللاقحي.

ترتبط معظم الانقسامات الخلوية ، بما في ذلك تلك التي تحدث في أجنة الفئران المبكرة والانقسامات الانقسامية في الثدييات ، بمراحل فجوة مرتبطة بدورة الخلية ، وبالتالي ستكون هناك حاجة إلى cdh1 في G1 لتنظيم الدخول إلى المرحلة S. ومع ذلك فإن البيض من بعض الأنواع يتمثل في Xenopus ، C. ايليجانس و ذبابة الفاكهة، يبدو أنه تم الاستغناء عن مراحل الفجوة. استنادًا إلى الاكتشاف الحالي لنشاط APC cdc20 و APC cdh1 أثناء الانقسام الاختزالي الثاني في بيض الفئران ، فربما لا تكون الحالة أن دورة الخلية الجنينية تختلف اختلافًا جوهريًا عن دورة الخلية في الخلايا البالغة. بدلاً من ذلك ، ربما يعكس نقص نشاط cdh1 في بيض وأجنة بعض الأنواع الحاجة إلى تسريع دورة الخلية للوصول إلى مرحلة الحركة وتجنب الافتراس.


ديناميات γ-secretase وركائزها

γ-Secretase هو غشاء أسبارتيل بروتياز يحفز الخطوة النهائية في التحلل البروتيني المنظم داخل الغشاء لعدد كبير من بروتينات الغشاء من النوع 1 وحيد الامتداد. أكثر الركائز التي تمت دراستها على نطاق واسع هي البروتين السلائف أميلويد بيتا (APP) ومستقبلات NOTCH. تقنية مهمة لتوصيف التفاعلات والتغيرات التوافقية التي تمكن γ-secretase من أداء التحلل المائي داخل حدود الغشاء هي محاكاة الديناميات الجزيئية على مقاييس زمنية وطول مختلفة. هنا ، نقوم بمراجعة السمات الهيكلية والديناميكية لـ γ − secretase وركائزه بما في ذلك أوصاف المرونة من عمليات المحاكاة والتجارب. نعالج (1) أخذ عينات مطابقة من إنزيم apo-enzyme وركائز غير منضمة (على سبيل المثال لـ APP و NOTCH1 والظاهرة غير الركيزة Integin β1) ، (2) مسارات تجنيد الركيزة ، (3) التغييرات التوافقية المرتبطة بتشكيل مجمع التعرف ، (4) موقع الانقسام يتكشف عند التفاعل مع الموقع النشط للإنزيم ، (5) معالجة الركيزة بعد تحلل البروتينات الداخلية ، و (6) تثبيط وتعديل γ-secretase. نختتم بالأسئلة التي لا تزال مفتوحة ونقترح المزيد من التحقيقات من أجل تعزيز فهمنا لكيفية اختيار γ-secretase للركائز ومعالجتها. ستعمل هذه المعرفة على تحسين القدرة على استهداف الركائز بشكل انتقائي للتطبيقات العلاجية.


محتويات

أ الناقل ليس مفتوحًا في وقت واحد لكل من البيئات خارج الخلية وداخل الخلايا. إما أن بوابته الداخلية مفتوحة ، أو البوابة الخارجية مفتوحة. في المقابل ، أ قناة يمكن أن يكون مفتوحًا لكلا البيئتين في نفس الوقت ، مما يسمح للجزيئات بالانتشار دون انقطاع. الناقلات لها مواقع ملزمة ، لكن المسام والقنوات لا تفعل ذلك. [5] [6] [7] عندما يتم فتح القناة ، يمكن لملايين الأيونات أن تمر عبر الغشاء في الثانية ، ولكن فقط من 100 إلى 1000 جزيء تمر عادة عبر الجزيء الحامل في نفس الوقت. [8] تم تصميم كل بروتين ناقل للتعرف على مادة واحدة فقط أو مجموعة واحدة من المواد المتشابهة جدًا. ربط البحث بين عيوب في بروتينات حاملة معينة وأمراض معينة. [9]

النقل النشط هو حركة مادة عبر غشاء مقابل تدرج تركيزها. هذا عادة لتراكم تركيزات عالية من الجزيئات التي تحتاجها الخلية ، مثل الجلوكوز أو الأحماض الأمينية. إذا كانت العملية تستخدم الطاقة الكيميائية ، مثل الأدينوزين ثلاثي الفوسفات (ATP) ، فإنها تسمى النقل النشط الأساسي. يتضمن النقل النشط الثانوي استخدام التدرج الكهروكيميائي ، ولا يستخدم الطاقة المنتجة في الخلية. [10] على عكس بروتينات القناة التي تنقل المواد فقط عبر الأغشية بشكل سلبي ، يمكن للبروتينات الحاملة نقل الأيونات والجزيئات إما بشكل سلبي من خلال الانتشار الميسر ، أو عن طريق النقل النشط الثانوي. [11] البروتين الحامل مطلوب لنقل الجزيئات من مناطق التركيز المنخفض إلى مناطق التركيز العالي. تحتوي هذه البروتينات الحاملة على مستقبلات ترتبط بجزيء معين (ركيزة) يحتاج إلى النقل. يجب أولاً ربط الجزيء أو الأيون المراد نقله (الركيزة) في موقع ربط عند الجزيء الحامل ، مع تقارب ارتباط معين. بعد الربط ، وبينما يواجه موقع الربط بنفس الطريقة ، سوف يلتقط الناقل أو يسد (يأخذ ويحتفظ) الركيزة داخل هيكله الجزيئي ويسبب إزاحة داخلية بحيث يواجه الفتح في البروتين الآن الجانب الآخر من غشاء البلازما. [12] يتم إطلاق ركيزة البروتين الحامل في هذا الموقع ، وفقًا لتقارب الارتباط الخاص بها هناك.

الانتشار الميسر هو مرور الجزيئات أو الأيونات عبر غشاء بيولوجي من خلال بروتينات نقل محددة ولا يتطلب أي مدخلات طاقة. يتم استخدام الانتشار الميسر خاصة في حالة الجزيئات القطبية الكبيرة والأيونات المشحونة بمجرد إذابة هذه الأيونات في الماء ولا يمكنها الانتشار بحرية عبر أغشية الخلايا بسبب الطبيعة الكارهة للماء لذيول الأحماض الدهنية للفوسفوليبيد التي تشكل الطبقات الثنائية. يختلف نوع البروتينات الحاملة المستخدمة في الانتشار الميسر قليلاً عن تلك المستخدمة في النقل النشط. لا تزال عبارة عن بروتينات حاملة عبر الغشاء ، لكنها قنوات غشائية مسورة ، مما يعني أنها لا تنتقل داخليًا ، ولا تتطلب ATP لتعمل. تؤخذ الركيزة في جانب واحد من الناقل المسور ، وبدون استخدام ATP ، يتم تحرير الركيزة في الخلية. يمكن استخدامها كمؤشرات حيوية محتملة.

النقل العكسي ، أو عكس الناقل، هي ظاهرة يتم فيها تحريك ركائز بروتين النقل الغشائي في الاتجاه المعاكس لاتجاه حركتها النموذجية بواسطة الناقل. [13] [14] [15] [16] [17] يحدث انعكاس الناقل عادة عندما يتم فسفرة بروتين نقل الغشاء بواسطة بروتين كيناز معين ، وهو إنزيم يضيف مجموعة فوسفات إلى البروتينات. [13] [14]

1: تحرير القنوات / المسام

  • قنوات البروتين الحلزونية α مثل القناة الأيونية ذات الجهد الكهربائي (VIC) ، والقنوات الأيونية المترابطة (LGICs)
  • β برميل بورينز مثل أكوابورين
  • السموم المكونة للقناة ، بما في ذلك القولون ، وسم الدفتيريا ، وغيرها
  • القنوات المركبة غير الريبوزومية مثل الجراميسيدين والتي تعمل في تصدير الإنزيمات التي تهضم جدران الخلايا البكتيرية في خطوة مبكرة من تحلل الخلية.

يحدث الانتشار الميسر داخل وخارج غشاء الخلية عبر القنوات / المسام والناقلين / الحمالين.

القنوات إما في حالة مفتوحة أو مغلقة. عندما يتم فتح قناة بمفتاح توافقي طفيف ، فإنها تكون مفتوحة لكلا البيئتين في وقت واحد (خارج الخلية وداخل الخلايا)

يتم فتح المسام باستمرار لهاتين البيئتين ، لأنها لا تخضع لتغييرات توافقية. هم دائما منفتحون ونشطون.

2: ناقلات النقل الكهروكيميائية المحتملة تحرير

تسمى أيضًا بروتينات حاملة أو ناقلات ثانوية.

3: تحرير الناقلات الأولية النشطة

    3.A: ناقلات P-P-bond-hydrolysis:
      (ناقل ABC) ، مثل MDR و CFTR ("V" المتعلق بالفراغ). ("P" المتعلقة بالفسفرة) ، مثل:

    4: مجموعة المترجمين تحرير

    يوفر المترجمون الجماعيون آلية خاصة لفسفرة السكريات حيث يتم نقلها إلى البكتيريا (انتقال مجموعة PEP)

    5: تحرير ناقلات الإلكترون

    تشتمل ناقلات نقل الإلكترون عبر الغشاء في الغشاء على حاملات ثنائية الإلكترون ، مثل رابطة ثنائي كبريتيد أكسيد الأكسيد (DsbB و DsbD في الإشريكية القولونية) بالإضافة إلى ناقلات الإلكترون الواحد مثل NADPH أوكسيديز. غالبًا لا تعتبر بروتينات الأكسدة والاختزال هذه بروتينات نقل.

    كل بروتين حامل ، خاصة داخل نفس غشاء الخلية ، خاص بنوع واحد أو عائلة من الجزيئات. على سبيل المثال ، GLUT1 هو بروتين حامل مسمى موجود في جميع أغشية الخلايا الحيوانية تقريبًا التي تنقل الجلوكوز عبر الطبقة الثنائية. تساعد البروتينات الحاملة المحددة الأخرى أيضًا الجسم على العمل بطرق مهمة. تعمل السيتوكرومات في سلسلة نقل الإلكترون كبروتينات حاملة للإلكترونات. [10]

    يتضمن عدد من الأمراض الموروثة عيوبًا في البروتينات الحاملة في مادة أو مجموعة خلايا معينة. Cysteinuria (السيستين في البول والمثانة) هو مثل هذا المرض الذي يصيب البروتينات الحاملة للسيستين المعيبة في أغشية خلايا الكلى. عادةً ما يزيل نظام النقل هذا السيستين من السائل المتجه إلى البول ويعيد هذا الحمض الأميني الأساسي إلى الدم. عندما يتعطل هذا الناقل ، تبقى كميات كبيرة من السيستين في البول ، حيث يكون غير قابل للذوبان نسبيًا ويميل إلى التعجيل. هذا هو أحد أسباب حصوات المسالك البولية. [18] وقد ثبت أن بعض البروتينات الحاملة للفيتامينات يتم إفرازها بشكل مفرط في المرضى المصابين بأمراض خبيثة. على سبيل المثال ، تبين أن مستويات البروتين الناقل للريبوفلافين (RCP) مرتفعة بشكل ملحوظ لدى الأشخاص المصابين بسرطان الثدي. [19]

    1. ^غشاء + نقل + بروتينات في المكتبة الوطنية الأمريكية للطب عناوين الموضوعات الطبية (MeSH)
    2. ^ بيرلاند ، إميلي باجشي ، سونشيتا كلايسون ، أكسل فريدريكسون ، روبرت (2017-09-01). "خصائص 29 حاملات مذابة غير نمطية جديدة من نوع العائلة الفائقة للميسرين الرئيسيين: الحفظ التطوري ، والبنية المتوقعة والتعبير المشترك للخلايا العصبية". فتح علم الأحياء. 7 (9): 170142. دوى: 10.1098 / rsob.170142. ISSN2046-2441. PMC5627054. PMID28878041.
    3. ^
    4. هيديجر ، ماتياس أ.روميرو ، مايكل ف. بينغ ، جي بن رولفز ، أندرياس تاكاناغا ، هيتومي بروفورد ، إلزبيث أ. (فبراير 2004). "أبجديات حاملات الذائبة: الآثار الفسيولوجية والمرضية والعلاجية لبروتينات نقل الغشاء البشري". أرشيف Pflügers: المجلة الأوروبية لعلم وظائف الأعضاء. 447 (5): 465-468. دوى: 10.1007 / s00424-003-1192-y. ISSN0031-6768. بميد14624363. S2CID1866661.
    5. ^ أب
    6. بيرلاند ، إميلي فريدريكسون ، روبرت (مارس 2017). "أنظمة تصنيف الناقلات الثانوية النشطة". الاتجاهات في العلوم الدوائية. 38 (3): 305-315. دوى: 10.1016 / j.tips.2016.11.008. ISSN1873-3735. PMID27939446.
    7. ^ سادافا ، ديفيد ، وآخرون. الحياة ، علم الأحياء ، الطبعة التاسعة. دار ماكميلان للنشر ، 2009. 1-4292-1962-9. ص. 119.
    8. ^
    9. كوبر ، جيفري (2009). الخلية: نهج جزيئي. واشنطن العاصمة: ASM Press. ص. 62. ردمك 9780878933006.
    10. ^ طومسون ، ليز أ. اجتياز اختبار نهاية الدورة التدريبية لولاية نورث كارولينا في علم الأحياء. شركة الكتاب الأمريكية 2007. 1-59807-139-4. ص. 97.
    11. ^
    12. أسمان ، سارة (2015). "النقل المذاب". في تعز ، لينكولن زيجر ، إدوارد. فسيولوجيا النبات والتنمية. سيناور. ص. 151.
    13. ^ سادافا ، ديفيد ، وآخرون. الحياة ، علم الأحياء ، الطبعة التاسعة. دار ماكميلان للنشر ، 2009. 1-4292-1962-9. ص. 119.
    14. ^ أب اشلي ، روث. هان ، غاري. بيولوجيا الخلية هان ، سيونغ س. دار العصر الجديد الدولية. 8122413978. ص. 113.
    15. ^ تعز ، لينكولن. زيجلر ، إدواردو. فسيولوجيا النبات والتنمية. سيناوير أسوشيتس ، 2015. 978-1-60535-255-8. ص 151.
    16. ^ كينت ، مايكل. علم الأحياء المتقدم. مطبعة جامعة أكسفورد ، الولايات المتحدة ، 2000. 0-19-914195-9. ص 157 - 158.
    17. ^ أب
    18. Bermingham DP، Blakely RD (أكتوبر 2016). "التنظيم المعتمد على كيناز لناقلات الناقلات العصبية الأحادية الأمين". فارماكول. القس. 68 (4): 888-953. دوى: 10.1124 / pr.115.012260. PMC5050440. بميد27591044.
    19. ^ أب
    20. Miller GM (يناير 2011). "الدور الناشئ للمستقبل المرتبط بالأمين 1 في التنظيم الوظيفي لناقلات أحادي الأمين ونشاط الدوبامين". مجلة الكيمياء العصبية. 116 (2): 164-176. دوى: 10.1111 / j.1471-4159.2010.07109.x. PMC3005101. بميد21073468.
    21. ^
    22. Scholze P ، Nørregaard L ، Singer EA ، Freissmuth M ، Gether U ، Sitte HH (2002). "دور أيونات الزنك في النقل العكسي بوساطة ناقلات أحادية الأمين". مجلة الكيمياء البيولوجية. 277 (24): 21505-13. دوى: 10.1074 / jbc.M112265200. PMID11940571.
    23. ^
    24. روبرتسون ، سد ، ماتيس هج ، جالي أ (2009). "نظرة فاحصة على النقل العكسي الناجم عن الأمفيتامين والاتجار بناقلات الدوبامين والنورادرينالين". علم الأعصاب الجزيئي. 39 (2): 73-80. دوى: 10.1007 / s12035-009-8053-4. PMC2729543. بميد19199083.
    25. ^
    26. Kasatkina LA ، Borisova TA (نوفمبر 2013). "إطلاق الجلوتامات من الصفائح الدموية: خروج الخلايا مقابل عكس ناقل الغلوتامات". المجلة الدولية للكيمياء الحيوية وبيولوجيا الخلية أمبير. 45 (11): 2585-2595. دوى: 10.1016 / j.biocel.2013.08.004. بميد 23994539.
    27. ^ شيروود ، لورالي. الإصدار السابع. فسيولوجيا الإنسان. من الخلايا إلى الأنظمة. تعلم Cengage ، 2008. ص. 67
    28. ^ راو ، بن ، ليفين ، إي وآخرون. رفع بروتين مصل الريبوفلافين الناقل في سرطان الثدي. السرطان Epidemiol Biomarkers السابق. المجلد 8 رقم 11. الصفحات 985-990

    Anderle، P.، Barbacioru، C.، Bussey، K.، Dai، Z.، Huang، Y.، Papp، A.، Reinhold، W.، Sadee، W.، Shankavaram، U.، & amp Weinstein، J. (2004). الناقلات والقنوات الغشائية: دور الناقل في الحساسية الكيميائية للسرطان والمقاومة الكيميائية. أبحاث السرطان ، 54 ، 4294-4301.


    المواد والأساليب

    زراعة الخلايا

    تم الحفاظ على خلايا COS-1 و HeLa و Vero في DMEM (Invitrogen ، Carlsbad ، CA) في ظل ظروف قياسية. تم إجراء عمليات النقل باستخدام 1-2 ميكروغرام من النواقل المناسبة كما هو موضح سابقًا (Chen and Okayama، 1987 Raggo وآخرون. ، 2002). عند الإشارة ، تمت إضافة بريفيلدين أ (التركيز النهائي 1 ميكروغرام / مل) إلى الخلايا عند 24 ساعة بعد تعداء العدوى ، وتم تحضين الثقافات أيضًا لمدة 4-8 ساعات. بالنسبة للدراسات التي تفحص تأثير تحريض استجابة البروتين غير المطوية ، تمت إضافة DTT في الوسط الطبيعي مع الأوقات والتركيزات الموضحة في أساطير الشكل.

    البلازميدات

    تم وصف بناء متجه (pJS6) ، يحتوي على تسلسل ترميز Luman (CREB3) ، محاطًا بعلامة حلقية SV5 عند نهايتها N وعلامة Hemagglutinin (HA) عند نهايتها C ، سابقًا (Raggo وآخرون. ، 2002). تم تضخيم تسلسل تشفير CREB4 من مكتبة HeLa cDNA (Marathon Ready cDNA BD Biosciences Clontech ، Palo Alto ، CA) ، باستخدام البادئات AGATCTATGGATCTCGGAATCCCTGACCC و CTCGAGCATCTCATCTG CATGCAGCACGG ، حيث أ Bglالثاني و زهوتم دمج موقع I في الاشعال 5 ′ و 3 ، على التوالي ، لتسهيل خطوات الاستنساخ اللاحقة. يمثل ATG الذي تحته خط يمثل البادئ ميثيونين ، وتم تصميم التمهيدي 3 بحيث يقرأ آخر ثلاثة أضعاف الترميز في الإطار إلى علامة C-terminal بعد خطوات الاستنساخ اللاحقة. ثم تم هضم الجزء المتضخم مع Bglالثاني و زهوأنا ، وإدراجه في ملف باممرحبا و زهوI مواقع pJS6 ، مما يؤدي إلى إنشاء بنية تعبر عن CREB4 (pJS23) سليمة ، وتم وضع علامة عليها عند الطرف N والنهاية C. باستخدام مواطن بامموقع HI أسفل موقع بدء CREB4 ، أ بامأهلا-زهوأنا جزء تم استنساخه أيضًا بين باممرحبا و زهوأنا مواقع pJS6 تنشئ متجهًا يعبر عن نسخة من CREB4 تفتقر إلى أول 22 وحدة بنائية (pJS24 CREB.ΔN1).

    تم إنشاء الوهم الذي يتكون من المجال الطرفي N لـ CREB4 (1-275) المدمج في المجالات عبر الغشاء والطرف C في Luman عن طريق هضم pJS23 مع BlpI ، موقع فريد طبيعي قبل العلاج المفترض لمجال الغشاء باستخدام T4 polymerase لإزالة الامتدادات 3 والهضم باستخدام زهوأزال هذا المجال عبر الغشاء والطرف C لـ CREB4 (المخلفات 276-395). شظية (سابقة بمعنى البيئةRV-زهوتم إدخال I) من pJS6 الذي يحتوي على الغشاء وذيل الطرف C لـ Luman (البقايا 220-371) لإنشاء pJS42 (CH2). تم إنشاء الوهم الذي يتكون من المجال الطرفي N ومنطقة الغشاء من CREB4 (1-324) المدمجة في المجال التجويفي الطرفي C لـ CREB3 (258-371) عن طريق تضخيم الطرف N ومجال الغشاء لـ CREB4 باستخدام البادئات AGATCTATGGATCTCGGAATCCCTGACCC و AGATCTAGACCCAGCTTCTGTCGAC. تم استنساخ هذا بين باممرحبًا عند المحطة N والداخلية Blpأنا موقع pJS6 لإنشاء متجه pJS43 (CH3). تم إنشاء كميرا إضافي (pJS66 ، CH6) يحتوي على الطرف N من CREB4 ، بما في ذلك مواقع الغشاء و S1P ، المرتبطة بالمجال التجويفي لـ Luman. لهذا الغرض ، تم تضخيم جزء C-terminal Luman باستخدام الاشعال CTCGAGGCCCTCCCCAGTGAGGACCCTAC و GATCCTCGAG GCCTGAGTATC TGTCCAG واستنساخها في زهوأنا موقع pJS60 لإنشاء وهم يتألف من مخلفات N-terminal 344 من CREB4 متبوعة بمخلفات 269-371 من Luman. أخيرًا ، تم إنشاء الوهم المتبادل الذي يحتوي على الطرف N من CREB3 مع مجال الغشاء ونهاية C لـ CREB4 (pJS58 ، CH4) عن طريق استبدال سابقة بمعنى البيئةRV-زهوأنا جزء من pJS6 يحتوي على ملف Blpأنا-زهوأنا جزء من pJS23.

    بالنسبة لطفرات الحذف ، كان CREB4.ΔTM (pJS32) كامل الطول ولكنه احتوى على حذف داخلي لإزالة مجال الغشاء المفترض (المخلفات 281-313). احتوت تركيبات الحذف الأخرى على الجزء N-terminal من البروتين ، CREB.ΔTMC1 ، مقطوع عند البقايا 276 ويفتقر إلى منطقة الغشاء والطرف C CREB4. في الموضع 335-338 CREB4.ΔC2 ، مقطوع عند البقايا 344 ويحتوي على الطرف N بالإضافة إلى مجال الغشاء وموقع S1P المفترض. تم تضخيم المخلفات 1-344 باستخدام الاشعال AGATCTATGGATCTCGGAATCCCTGACCC و CTCGAGTGTTACGTCCTTGTGGGTCAGG ، وتم استنساخ (كدنا) الناتج بين باممرحبا و زهوأنا مواقع pJS23. تم صنع CREB4.ΔC1 عن طريق هضم pJS23 مع سالانا و زهوأنا ، أعامل مع Klenow وأدين. يحتوي هذا على بقايا 1-319 من CREB4 ويتضمن سبع بقايا (HKGEPAS) قبل كودون الإيقاف الجديد. تم تأكيد جميع التركيبات بالتسلسل وتم تلخيص هياكلها بالأرقام المناسبة.

    تم إنشاء اندماج مجال ربط الحمض النووي لـ CREB 4 إلى GAL4 باستخدام مجال ربط الحمض النووي لـ GAL4 pM1 (Sadowski وآخرون. ، 1992). تم تضخيم CREB4 من pJS23 باستخدام البادئات GAATTCATGGATCTCGGAATCCCTGAC و CTCGAGTTAكاجكتجكاتاجتكاجك. هذا المنتج ، الذي يحتوي على CREB4 كامل الطول مع إضافة علامة HA عند الطرف C متبوعًا بكودون إنهاء ، تم هضمه باستخدام سابقة بمعنى البيئةRI و زهوأنا وأدرجت بين سابقة بمعنى البيئةRI و سالأنا مواقع pM1 لإنتاج pJS55 ، معبرة عن مجال ربط DNA GAL4 المدمج في CREB4 كامل الطول. لإنتاج اندماج GAL4 إلى المنطقة الطرفية N فقط من CREB4 ، تم هضم pJS44 (CREB.ΔTMC1) باستخدام هندالثالث و Xbaأنا لعزل مخلفات N- الطرفية 1-276 ، والتي تم استنساخها بين هندالثالث و Xbaأنا مواقع pJS55 لإنتاج pJS62.

    تم بناء ناقل يعبر عن بروتين الانصهار الأخضر (GFP) -CREB4. عن طريق إدخال جزء (نديأنا-بامHI) الذي يحتوي على تسلسل الترميز لـ GFP من pEGFP-C1 (BD Biosciences Clontech) إلى pJS23 لإنشاء ناقل يعبر عن بروتين اندماج لـ CREB4.ΔN1 مع GFP عند الطرف N (pJS51). ال Bglثانيا-Blpتم نقل جزء I من CREB4 السليم إلى باممرحبا و BlpI مواقع pJS51 تعبر عن بروتين الانصهار GFP-CREB4 السليم مع GFP عند الطرف N (pJS52).

    لإنشاء متجه تعبير لـ OASIS ، تم هضم cDNA (معرف الصورة 4856946) باستخدام بامأهلا. يحتوي استنساخ (كدنا) على مواطن بامموقع HI في بقايا 17 من OASIS و a باممرحبا في ناقلات البلازميد. 1.5 كيلو بايت بامتم بعد ذلك نقل جزء HI الذي يشتمل على المخلفات 17 إلى بقايا الطرف C (519) إلى pJS6 لإنشاء ناقل وسيط pJS6OAS1. لإنشاء متجه التعبير مثل احتواء OASIS على نفس علامة HA للطرف C مثل التركيبات الأخرى ، فإن البادئات GGTCACCAACAAGATCTCCAGACC تحتوي على Bstموقع EII و CTCGAGGGAGAGTTTGATGGTGG التي تحتوي على ملف زهوتم استخدام موقع I لتضخيم الطرف الثالث لمنطقة التشفير (المخلفات 354-519) ، بحيث يمكن قراءة المنطقة في الإطار عند إدخالها في pJS6OAS1. يتم هضم جزء (كدنا) مع BstEII و زهوثم تم إدراجي بين ملف Bstمواقع EII (في Oasis) و XhoI (Vector) لـ pJS6OAS1 لإنشاء ناقل وسيط ثانٍ ، pJS6OAS2. لإكمال الاستنساخ ، تم بعد ذلك تضخيم الطرف الخامس لمنطقة تشفير OASIS من استنساخ Image cDNA باستخدام البادئات (AGATCT)ATGGACGCCGTCTTGG) و (TCCGGACTCTCTTCAAGGCCTTC). تم هضم هذا الجزء البالغ 874 نقطة أساس مع Bglالثاني و بسEI والمستنسخة بين باممرحبا والوطني بسمواقع EI لـ pJS6OAS2 لإنتاج بنية تعبر عن OASIS سليمة مع حاتمة SV5 عند الطرف N وحلقة HA ​​عند المحطة C (pJS22).

    كانت إستراتيجية إنشاء متجه تعبير لـ CREB-H هي نفسها التي تم وصفها أعلاه لـ CREB4 من مكتبة HeLa (كدنا) باستخدام البادئات CGCGGATCCATGAATACGGATTAGCTGC و ACGCGTCGACكاجكتكجتكتكككجككككت. الجزء بامأهلا-ساللقد تم استنساخي في ملف بامأهلا-زهوI مواقع pJS6 (pSM20). تم توفير التركيب الذي يعبر عن ATF6 (p3XFLAG-CMV-ATF6) والمتغير N-terminal 1-373 من قبل الدكتور رون بريويس (قسم العلوم البيولوجية ، جامعة كولومبيا ، نيويورك ، نيويورك). تم توفير ناقلات التعبير لـ S1P من قبل الدكتور جوزيف جولدشتاين (قسم الوراثة الجزيئية ، جامعة تكساس ، المركز الطبي الجنوبي الغربي ، دالاس ، تكساس).

    الطفرات

    تم إجراء تحور موقع انشقاق S1P داخل CREB4 باستخدام مجموعة QuikChange (ستراتجين ، لا جولا ، كاليفورنيا). داخل CREB4 ، يقع التسلسل 335-RNIL-338 20 بقايا في اتجاه مجرى منطقة الغشاء. تم إنشاء نسخة متحولة إما من CREB4 (pJS50) أو CREB4.جغاتاتككتجاككاكاكاج و كتجتجتكاجاتاتتككجAAGTCACTCC. تم تغيير طبيعة البلازميدات الأبوية pJS24 أو pJS60 واحتضانها باستخدام البادئات وفقًا لتعليمات الشركة الصانعة. بعد الانتهاء من التفاعل ، تم هضم العينة باستخدام Dpnأقوم بإزالة قالب البلازميد الأبوي ثم تحويله. تم تأكيد إدخال الطفرة في هذا البناء كما هو الحال بالنسبة لجميع التركيبات من خلال تسلسل البلازميد.

    تألق مناعي

    تم نقل الخلايا المزروعة على الأغطية باستخدام 2 ميكروغرام من ناقل التعبير المناسب. عند -30 ساعة بعد تعداء العدوى ، تم غسل الخلايا في محلول ملحي مخزّن بالفوسفات (PBS) وتثبيتها لمدة 15 دقيقة في الميثانول عند -20 درجة مئوية. بعد الحجب في PBS الذي يحتوي على 10٪ من مصل العجل الجنيني ، تم تطبيق الأجسام المضادة الأولية المخففة في محلول المنع. وشملت هذه الأجسام المضادة أحادية النسيلة SV5 (1/10000) لعلامة SV5 ومضاد FLAG M2 (1/1000 ستراتاجين) ومضاد متعدد النسيلة لـ GFP (1/500 Research Diagnostics ، Flanders ، NJ) ، anti-calreticulin (1/500) ، Calbiochem ، سان دييغو ، كاليفورنيا) ، ومكافحة β-Cop (1/100 Affinity Bioreagents ، Golden ، CO). بعد الغسيل في العديد من التغييرات في برنامج تلفزيوني ، تم تطبيق الأجسام المضادة الثانوية المقترنة مع Alexa 488 أو Alexa 543 (Invitrogen) بتخفيف 1/200. بعد الحضانة لمدة 20 دقيقة ، تم غسل الشرائح مرة أخرى وتركيبها في Mowiol (Sigma Chemical ، Poole ، Dorset ، المملكة المتحدة). بالنسبة لدراسات التوطين ، تم نقل CREB4 أيضًا مع البلازميد (بروتين فلوري أصفر مُحسَّن [EYFP] -Golgi BD Biosciences Clontech) ، والذي يعبر عن إشارة استهداف جولجي لـ β-galactosyl transferase المنصهر في بروتين الفلورسنت الأصفر. تم الحصول على صور مضان على مجهر متحد البؤر المسح بالليزر زايس LSM410. تم الحصول على الصور بشكل روتيني باستخدام العدسة الموضوعية للغمر بالزيت Plan-apochromat 63 × ، والفتحة العددية 1.4 ، وعوامل التكبير التي تتراوح من 1 إلى 8 من برنامج الاستحواذ LSM 410.

    فحوصات Luciferase

    تم نقل خلايا COS مع نواقل مختلفة للتعبير والهدف ، وتم تحضير محللات الخلية بعد 24 أو 48 ساعة من تعداء العدوى عن طريق إضافة محلول تحلل Glo (Promega ، Madison ، WI). تم تحديد نشاط Firefly luciferase باستخدام نظام الفحص Bright-Glo كما هو موصوف من قبل الشركة المصنعة (Promega).

    بالنسبة لتجارب الاندماج GAL4 ، تم نقل 2 ميكروغرام من ناقل الهدف التجاري الذي يحتوي على خمسة مواقع ربط GAL4 ، pFR-LUC (ستراتاجين) بكميات مختلفة (0 ، 0.25 ، 1 ، أو 4 ميكروغرام) من pM1 (ناقل فارغ يعبر عن GAL4 DNA مجال الربط وحده) أو pJS55 (GAL4-CREB4) أو pJS62 (GAL4-CREB4.ΔTMC1).

    في فحوصات التنشيط الأخرى ، تمت مقارنة نشاط CREB4 الأصلي والمتغيرات مع ATF6 باستخدام المتجهات pJS23 (CREB4) ، و pJS44 (CREB4.ΔTMC1 ، المخلفات 1-276) ، p3XFLAG-CMV-ATF6 ، و pCGNATF6 (1-373). تم توفير هذين النواقل الأخيرين من قبل الدكتور رون بريويس وتم وصفهما مسبقًا (Wang وآخرون، 2000). تم نقلها مع ناقلات مستهدفة تحتوي على عدة مواقع ربط ATF6 ، 5XATF6-GL3 (2 ميكروغرام) ، أو ناقلات تحتوي على المروجين الأصليين لمرافقي ER مثل GRP78 ، مروج pGL3-GRP78 (0.5 ميكروغرام). هذا المتجه ، الذي تم توفيره من قبل الدكتور موري (معهد أبحاث HSP ، حديقة أبحاث كيوتو ، كيوتو ، اليابان) ، تم وصفه مسبقًا (يوشيدا وآخرون., 1998).

    النشاف الغربي

    تم غسل ثقافات الخلايا المنقولة (1-2 × 10 5 خلايا) في برنامج تلفزيوني بارد ، وتم تحضير المحلول الكلي بإضافة 200 ميكرولتر من المخزن المؤقت لتحميل SDS. تم صوتنة العينات لفترة وجيزة وغليها قبل الرحلان الكهربائي. تم تجزئة كميات متساوية من إجمالي البروتينات بواسطة SDS-PAGE ونقلها إلى أغشية Hybond-C (GE Healthcare ، Little Chalfont ، Buckinghamshire ، المملكة المتحدة). تم حظر الأغشية باستخدام PBS الذي يحتوي على 5٪ لبن خالي من الدسم و 0.1٪ توين 20. كانت الأجسام المضادة الأولية المخففة في محلول مانع هي مضاد SV5 (1/10000) ومضاد FLAG M5 (1/1000 Sigma Chemical). تم الكشف عن عصابات البروتين من خلال الإجراءات القياسية للكشف عن اللمعان الكيميائي


    مراجع

    الشكل S1. يُظهر توصيف الجسم المضاد الذي يتعرف على DCas وطفرات DCas تكوينًا طبيعيًا للعضلات وتحديد مصير الخلايا العصبية. (أ,ب) توصيف جسم مضاد تم إنشاؤه ضد ببتيد p130Cas للثدييات شديد الحفظ والذي يتعرف على DCas. اتخذنا عدة طرق مختلفة لوصف الجسم المضاد الذي تم التعرف عليه ذبابة الفاكهة كاس. حاولنا أولاً إنتاج أجسام مضادة ضد Cas عن طريق تحصين الفئران بـ a ذبابة الفاكهة بروتين كاس فيوجن. كنهج تكميلي ، منذ مناطق ذبابة الفاكهة تم الحفاظ على Cas بشكل كبير مع الفقاريات Cas وعدد من ذبابة الفاكهة غالبًا ما تتفاعل البروتينات التبادلية مع الأجسام المضادة للثدييات (مثل Colville et al. Miller and Benzer ، 1983) ، وقد حصلنا على جميع الأجسام المضادة Cas للفقاريات المنشورة والتي تعرفت على حاتمة محفوظة بدرجة عالية في ذبابة الفاكهة كاس. ثم أخذنا الطول الكامل الموسومة بعلامة Myc DCas، استنساخه إلى ناقل تعبير للثدييات (pRK5) ، وأفرط في التعبير عنه في خلايا زراعة الأنسجة ، وفحص مضادات DCas والأجسام المضادة للفقاريات من أجل قدرتها على التعرف على DCas على لطخة غربية. لقد جربنا تسعة أنواع مختلفة من الأجسام المضادة المتاحة تجاريًا ومضاداتنا المضادة. على الرغم من أن ذبابة الفاكهة لم يعترف كاس antisera ذبابة الفاكهة Cas ، حددنا جسمًا مضادًا واحدًا تم التعرف عليه بشكل مفرط ذبابة الفاكهة Myc DCas عندما يتم التعبير عنها في 293 خلية. (أ) تم فحص Lysates من 293 خلية منقولة باستخدام Myc DCas لوجود نطاق مناعي يقابل نفس حجم بروتين Myc DCas كما هو متصور مع جسم مضاد ضد Myc (الممر 1). كان النطاق (السهم) موجودًا في محلول من 293 خلية منقولة باستخدام Myc DCas (الممر 3) والذي كان غائبًا في التحكم 293 خلية (الممر 2) عند مسحه باستخدام الجسم المضاد phospho410-p130Cas (Cas). يتم أيضًا ملاحظة العصابات التي يُفترض أنها بروتينات Cas للثدييات الداخلية. (ب) ذبابة الفاكهة الأجنة التي تعبر عن DCas (Myc DCas) أو DCas التي تفتقر إلى مجال SH3 (Myc-ΔSH3 DCas غير منشورة) باستخدام إيلاف غال 4 سائق أو DCas P1 - GAL4 تم التنميط الجيني لخط متحولة LOF وخضع للتحليل الغربي بأجسام مضادة متولدة ضد Myc أو Cas (phospho410-p130Cas). يتعرف الجسم المضاد لـ Myc على Myc DCas المعبر عنها في جميع الخلايا العصبية باستخدام إيلاف غال 4 سائق (حارة 1). يتعرف الجسم المضاد phospho410-p130Cas على نطاق من نفس الحجم عندما يتم التعبير عن Myc DCas في جميع الخلايا العصبية (الممر 2). يتعرف الجسم المضاد لـ Myc على Myc-DCas المعبر عنها في a DCas P1 متحولة الخلفية باستخدام DCas P1 -GAL4 سائق (حارة 3). يتعرف الجسم المضاد phospho410-p130Cas على Myc DCas المعبر عنها في a DCas P1 متحولة الخلفية باستخدام DCas P1 -GAL4 سائق (حارة 4). يتعرف الجسم المضاد لـ Myc على Myc-ΔSH3 DCas المعبر عنه في a DCas P1 متحولة الخلفية باستخدام DCas P1 -GAL4 سائق (حارة 5). يتعرف الجسم المضاد phospho410-p130Cas على Myc-ΔSH3 DCas المعبر عنها في DCas P1 متحولة الخلفية باستخدام DCas P1 -GAL4 سائق (حارة 6). ويعطى الوزن الجزيئي بالكيلو دالتون. (سي إي) توصيف خط فخ محسن يعبر عن DCas في نمطه الداخلي. لتوصيف توزيع بروتين DCas بشكل أكبر ، استفدنا من خط فخ محسن P-element حيث أ جال 4 يتم إدراج عنصر المروج في DCas الجين المصب لموقع البداية متعدية (DCas P1 -Gal4، انظر الشكل 1 أ). موقع DCas P1 -Gal4 اقترح أن يتم التعبير عن Gal4 تحت سيطرة الذاتية DCas المروج ، مما يسمح بتقييم توزيع بروتين DCas. لاختبار هذه الفكرة ، قمنا بإنشاء علامة Myc كاملة الطول DCas التحوير تحت سيطرة مروج الطائرات بدون طيار (UAS- Myc DCas). باستخدام نظام Gal4-UAS ، حددنا أولاً متى UAS- Myc DCas تم التعبير عنها في جميع الخلايا العصبية باستخدام المحرك الخاص بالخلايا العصبية إيلاف غال 4، لوحظ تلطيخ مناعي Myc DCas في الجهاز العصبي المركزي والمحاور الحركية على طول مسارات المحاور وفي مواقع تعصيب العضلات. (ج) مرحلة إعداد شرائح 16/17 لجنين معربا عن Myc DCas تحت سيطرة عموم الخلايا العصبية إيلاف غال 4 المروجين (إيلاف- GAL4/+ UAS- Myc DCas/+) مناعي مع الأجسام المضادة Myc يظهر أن قيادة تعبير Myc DCas في جميع الخلايا العصبية ينتج عنه توطين Myc DCas في المحاور الحركية (العلامات النجمية) وداخل أعصاب ISNb (الأسهم السوداء) و SNa (الأسهم المفتوحة). (د ، ه) عبرنا UAS- Myc DCas يتماشى مع DCas P1 -Gal4 خط وملاحظة Myc DCas المناعية في المحاور العصبية الصوارية والطولية للجهاز العصبي المركزي ، في المحاور الحركية وفي مواقع تعصيب العضلات ، وعند حدود القطع في مواقع التعلق العضلي. (د) مرحلة الجنين 15 معربا عن Myc DCas تحت الذاتية DCas المروج ، على النحو الذي يدفعه DCas P1 عنصر ف GAL4 فخ محسن (DCas P1 -GAL4/+ UAS- Myc DCas/+) ، معزز بجسم مضاد ضد Myc. يُرى تعبير Myc DCas في مجموعات من الخلايا العصبية للجهاز العصبي المركزي (ن) ، داخل محاور تشغل المفصلات الأمامية (A) والخلفية (P) ، والوصلات الطولية (L) وداخل جذور الأعصاب الحركية (العلامات النجمية). (E) تعبير Myc DCas مدفوعًا بالحيوية الذاتية DCas كما لوحظ المروج في مواقع التعلق العضلي (رؤوس الأسهم) وفي عضلات الأعصاب ISNb 6 و 7 (السهم). تُظهر هذه النتائج أن Myc DCas المعبر عنها في الجهاز العصبي المركزي النامي يترجم إلى إسقاطات الجهاز العصبي المركزي والمحاور الحركية ، وتدعم بقوة فكرة أن DCas الذاتية يتم التعبير عنها في الخلايا العصبية أثناء التطور. (F-L) تكوين العضلات الطبيعي وتحديد مصير الخلايا العصبية في DCas المسوخ. β1 إنتيجرين (خواص) الطفرات الفارغة مميتة للجنين وتؤدي إلى انفصال كامل للعضلات (Leptin et al. ، 1989 Wright ، 1969). في α2 إنتغرين (لو) المتحولة ، تتطور العضلات بشكل طبيعي خلال المرحلة 17, بعد النقطة التي حدث فيها المحرك الجنيني وأحداث توجيه محور عصبي للجهاز العصبي المركزي التي نقوم بتقييمها ، ثم انفصلوا عن مواقع ارتباطهم العضلي ولكنهم ظلوا ممتدين (Hoang and Chiba ، 1998 Prokop et al. ، 1998). نرى نتائج مماثلة في بعض الأحيان رأينا عيوبًا في العضلات الأساسية كما تم الحكم عليها من خلال بصريات نومارسكي (على سبيل المثال في α2 إنتغرين المسوخ) لم يتم تضمين هذه الأجزاء في تحليلنا لعيوب توجيه محور عصبي. في α1 إنتغرين (موا) الطفرات والعضلات تتطور وتتعلق بشكل طبيعي أثناء التطور الجنيني ، وتموت الطفرات أثناء مراحل اليرقات (Brower et al. ، 1995 Roote and Zusman ، 1995). نظرًا لأن DCas يتم التعبير عنها بشكل كبير في مواقع التعلق العضلي بالإضافة إلى الجهاز العصبي ، فقد قمنا بفحص ما إذا كانت العيوب في تنظيم العضلات و / أو تحديد مصير الخلايا العصبية قد تساهم في عيوب توجيه المحور العصبي التي نراها في DCas المسوخ. النوع البري ذبابة الفاكهة تظهر الأجنة نمطًا متكررًا جزئيًا للعضلات التي يمكن تصورها باستخدام الجسم المضاد للميوسين العضلي أثناء ارتباطها بالبشرة في مواقع التعلق العضلي (Bate ، 1993). (F-I) تنظيم ألياف العضلات في ذبابة الفاكهة الأجنة كما هو متصور مع الجسم المضاد (FMM5) (Kiehart and Feghali ، 1986) الخاص بالميوسين العضلي حيث يشار إلى مواقع التعلق العضلي المختارة (بين رؤوس الأسهم). (F-G) التنظيم الطبيعي للألياف العضلية كما هو متصور في جزأين من جنين من النوع البري (F) ، وفي قوة أعلى تكشف عن العضلات 6 و 7 و 12 و 13 (G). (مرحبا في DCas تظهر طفرات LOF وسلامة العضلات كما يتم عرضها مع بصريات Nomarski أن تكوين العضلات لم يتم تعطيله (انظر الشكلين 3 و 4). يظهر النمط الطبيعي للألياف العضلية أيضًا في DCas متحولة LOF (ديكاس دي اف (3 لتر) اكسيل 6083 /ديكاس دي اف (3 لتر) اكسيل 6083 ) الأجنة الملطخة بالجسم المضاد للميوسين العضلي (H) ، بما في ذلك التشكل والتعلق بالعضلات 6،7 و 12 و 13 (I). تتوافق هذه النتائج مع قدرتنا على إنقاذ عيوب توجيه المحور العصبي التي شوهدت في طفرات DCas LOF مع التعبير الخاص بالخلايا العصبية لـ DCas (انظر الشكل 3I ، الشكل 4J والشكل S2 في المادة التكميلية). (J-L) يمكن أن تنتج عيوب توجيه المحور العصبي أيضًا عن فقدان الخلايا العصبية في الحبل العصبي البطني أو تغييرات في تمايز الخلايا العصبية أو المواصفات (Landgraf et al.، 1999 Thor et al.، 1999). لذلك ، قمنا بفحص التنظيم العصبي للحبل العصبي البطني في DCas المسوخ. لم يلاحظ أي شذوذ في التشكل الخلوي للحبل العصبي في طفرات DCas باستخدام الجسم المضاد Fas2 وتصوير Nomarski (البيانات غير معروضة). فحصنا بعد ذلك DCas المسوخ لوجود أو عدم وجود العصبونات الحركية المحددة.على وجه الخصوص ، نظرًا لأننا نرى عيوب توجيه محور عصبي في DCas المسوخات حيث تظل محاور ISNb محاطة بمحاور ISN ، سألنا عما إذا كانت عيوب توجيه المحاور هذه هي نتيجة تحويل الخلايا العصبية ISNb إلى خلايا ISN العصبية. يعتبر البروتين المتخطي (Eve) علامة ممتازة للخلايا العصبية ISN حيث يتم التعبير عنه في ما يقرب من 16 خلية لكل جزء بطني ، بما في ذلك ستة من الخلايا العصبية (واحد aCC ، واحد RP2 ، أربعة CQ / U الخلايا العصبية) التي تؤدي إلى محاور عصبية التي تشكل عصب ISN (Doe et al. ، 1988 Landgraf et al. ، 1997 Landgraf et al. ، 1999 Patel et al. ، 1989). يؤثر تغيير مستويات Eve على مسارات المحاور العصبية لهذه الخلايا العصبية (Doe et al. ، 1988 Landgraf et al. ، 1999). (J) يتم عرض اثنين من هذه الخلايا العصبية ISN (aCC ، الأحمر RP2 ، الأخضر) بشكل تخطيطي في ثلاثة أجزاء من النوع البري ذبابة الفاكهة الجنين (رؤوس الأسهم). (ك) تم العثور على تكملة طبيعية للخلايا العصبية aCC (رأس السهم الأحمر) و RP2 (رأس السهم الأخضر) في DCas المسوخ (ديكاس دي اف (3 لتر) اكسيل 6083 /ديكاس دي اف (3 لتر) اكسيل 6083 ). (L) الأجنة التي يتم فيها التعبير عن مستويات عالية (+++) من Myc DCas في جميع الخلايا العصبية باستخدام إيلاف غال 4 يُظهر السائق في خلفية من النوع البري (Neuronal DCas GOF انظر الشكل 5 والشكل S2 في المادة التكميلية والجدول 1) أيضًا المكمل الطبيعي للخلايا العصبية aCC (رأس السهم الأحمر) و RP2 (رأس السهم الأخضر). أشرطة المقياس: 20 ميكرومتر في C 13 ميكرومتر في D 7 ميكرومتر في E in G ، 10 ميكرومتر لـ F-I في J ، 5 ميكرومتر لـ J-L.

    الشكل S2. يتم التعبير عن Cas بشكل كبير في الحبل الشوكي للثدييات وتظهر طفرات DCas عيوب توجيه محور عصبي في الجهاز العصبي المركزي. (أ-ه) يتم التعبير عن بروتينات كاس بشكل كبير في الحبل الشوكي للثدييات. تم إجراء المناعة المناعية للحبل الشوكي P0 الجرذ باستخدام الأساليب القياسية (Terman et al. ، 2000). تم ترطيب صغار الفئران P0 ، وإزالة الحبل الشوكي والعمود الفقري المحيط ، وتم قطع المقاطع عند 20 ميكرون على ناظم البرد. تم بعد ذلك تحصين المقاطع المثبتة على الشرائح بجسم مضاد محدد بما في ذلك الجسم المضاد أحادي النسيلة المتولد ضد الفئران p130Cas (Clone 8G4-E8 ، 1: 400 Upstate Biotechnology) ، وهو جسم مضاد أحادي النسيلة تم إنشاؤه ضد الفأر Sin (Clone 13 ، 1: 400 ، BD Transduction Labs ) الذي يتعرف أيضًا على الفئران Sin ، والأجسام المضادة متعددة النسيلة الخاصة بالعديد من أشكال التيروزين الفسفورية من p130Cas: phospho-p130Cas (Tyr249) ، # 4014 ، Lot # 1 ، 1: 100 ، تقنيات تشوير الخلايا phospho-p130Cas (Tyr410) ، # 4011 ، مجموعة 1 ، 1: 200 ، تقنيات تشوير الخلايا). أجسام مضادة إضافية تم إنشاؤها ضد أعضاء عائلة بروتينات Cas بما في ذلك الفئران أحادية النسيلة المضادة لـ p130Cas (Clone 21 ، 1: 400 ، BD Transduction Labs) ، الفئران أحادية النسيلة المضادة لـ p130Cas (CAS-14 ، 1: 400 ، Chemicon International) ، أرنب متعدد النسيلة anti-Cas (N-17 ، Lot # I101 ، 1: 500 Santa Cruz Biotechnology) ، أرنب متعدد الأضلاع مضاد للفوسفو p130Cas phospho-p130Cas (Tyr165) ، # 4015 ، Lot # 1 ، 1: 100 ، تقنيات تشوير الخلايا والماعز تم العثور على polyclonal anti-p130Cas (S-20 ، Lot # B282 ، 1: 100 ، Santa Cruz Biotechnology) لإعطاء نتائج مماثلة. (A-D) المقاطع المتجاورة المأخوذة عند المستويات القطنية العجزية للحبل الشوكي P0 الجرذ المحصن بأجسام مضادة تتعرف على أفراد عائلة Cas المختلفين. DF ، funiculus dorsal dLF ، funiculus dorsolateral vLF ، البطني الوحشي الوحشي VF ، الجبلي الجبلي البطني cc ، القناة المركزية dr ، الجذور الظهرية nr ، جذر العصب. (أ) يُظهر الجسم المضاد أحادي النسيلة الذي يتعرف على جميع أفراد عائلة الفئران الثلاثة (Clone 8G4-E8) أن بروتينات Cas يتم التعبير عنها بقوة في المادة الرمادية والبيضاء للحبل الشوكي للفئران. كانت الخلايا العصبية المحصنة بالمناعة موجودة في كل صفيحة ريكسيد. (ب) عرض عالي القدرة للمنطقة الموضحة في A في قسم مجاور مملوء بالمناعة بجسم مضاد متعدد الأضلاع (phospho249-p130Cas) موجه ضد شكل فسفرة من p130Cas. يشار إلى الخلايا العصبية المسمى (رؤوس الأسهم) وعملياتها (الأسهم). (C) عرض عالي الطاقة لمنطقة الحبل الشوكي الموضحة في A من قسم مجاور محمل بالمناعة بجسم مضاد متعدد الأضداد مختلف (phospho410-p130Cas) موجه ضد شكل فسفري من p130Cas. يتم عرض Lamina IX ويحتوي على ما يحتمل أن يكون ، بناءً على الموقع وحجم جسم الخلية ، أجسام الخلايا العصبية الحركية المناعية (داخل دائرة النقاط السوداء) ومحاورهم (الأسهم). (D) عرض عالي الطاقة لمنطقة الحبل الشوكي الموضحة في A من قسم مجاور معزز بجسم مضاد أحادي النسيلة خاص بـ Efs / Sin (Clone 13). يظهر التلقيح المناعي القوي في الحبل البطني ويشار إلى الخلايا العصبية المختارة المناعية (السهم الأبيض ، السهم الأوسط للجهاز العصبي المركزي). (هـ) تمت إزالة الخلايا العصبية لعقدة عنق الرحم المتفوقة (SCG) وفصلها وزرعها باستخدام التقنيات القياسية (Qian et al. ، 1998). تم بعد ذلك جمع Lysates من الخلايا العصبية SCG وتشغيلها على SDS-PAGE وتم إجراء التحليل الغربي باستخدام الأساليب القياسية. تم تلطيخ البقعة الغربية بعد ذلك باستخدام الأجسام المضادة التي تتعرف على p130Cas و CasL و Sin (Cas ، N-17 ، 1: 500 Santa Cruz Biotechnology). يتم التعبير عن كل من Cas و CasL و Efs / Sin (الأسهم) في الخلايا العصبية SCG. (F-P) DCas تظهر المسوخات LOF و GOF عيوب توجيه محور عصبي للجهاز العصبي المركزي. (F) في البرية من النوع و ديكاس دي اف (3 لتر) اكسيل 6083 / + الأجنة ، تم الكشف عن ثلاثة مسارات محاور طولية رئيسية (المسمى 1 ، 2 ، 3 في أ) باستخدام الجسم المضاد 1D4. عادةً ما تكون هذه المسارات متباعدة بشكل متساوٍ وذات سمك موحد نسبيًا (تشير الأسهم المفتوحة في F و I و J إلى الرابط الطولي الثالث). (G) المحاور المساهمة في الطولي الثالث في DCas الأجنة الطافرة LOF أرق من الطبيعي ، وغير متصلة وغالبًا ما تكون غير موجودة (السهم). (H) المحاور التي تشكل المحور الطولي الثالث في α1 إنتغرين (موا M6) المسوخ إما غير طبيعي في المظهر أو غائب في كثير من الأحيان (السهم). (I ، J) التعبير عن DCas ينقذ عيوب الجهاز العصبي المركزي التي لوحظت في DCas المسوخ. (I) التعبير عن Myc DCas تحت DCas P1 -GAL4 يستعيد السائق الرابط الطولي الثالث في DCas المسوخ (UAS- Myc DCas/+ دي إف (3 لتر) ED201/DCas P1 ) (الأسهم المفتوحة). (J) التعبير العصبي عن Myc DCas باستخدام إيلاف غال 4 يقوم السائق أيضًا باستعادة الرابط الضام الطولي الثالث في DCas المسوخ (إيلاف غال 4/UAS- Myc DCas DCas Df (3L) Exel6083 /ديكاس دي اف (3 لتر) اكسيل 6083 ) (الأسهم المفتوحة). (K-P) الإفراط في التعبير عن Myc DCas في جميع الخلايا العصبية باستخدام عموم الخلايا العصبية إيلاف غال 4 يؤثر السائق بشكل كبير على المسارات المحورية للجهاز العصبي المركزي. تم فحص ثلاثة مستويات مختلفة من التعبير المفرط لـ Myc DCas: الإفراط في التعبير باستخدام نسخة واحدة من كليهما Myc DCas مراسل و إيلاف غال 4 سائق (+ الجدول 1) ، الإفراط في التعبير عن نسختين من كليهما Myc DCas و إيلاف غال 4 (++) ، والإفراط في التعبير عن نسختين من كليهما Myc DCas و إيلاف غال 4 عند درجة حرارة مرتفعة (29 درجة مئوية) للحث على مستويات تعبير Myc DCas أعلى (+++). (KL) فحص محاور الجهاز العصبي المركزي في الأجنة التي تُفرط في التعبير عن DCas في جميع الخلايا العصبية باستخدام علامة تسمي جميع المحاور الصوارية والطولية ، BP102 (Seeger وآخرون ، 1993) ، يكشف عن اختلاف ملحوظ عن المظهر الطبيعي الذي يشبه السلم لمحاور الجهاز العصبي المركزي التي لوحظت في أجنة من النوع البري. ينتج عن التعبير العصبي خارج الرحم لـ DCas وصلات طولية معطلة ومفاصل غير طبيعية ، وهو نمط ظاهري مشابه تمامًا لما لوحظ في غياب دوار مستقبلات الشق (Robo) أو زيادة الإشارة بواسطة مستقبلات Netrin Frazzled / DCC (Bashaw and Goodman، 1999 Kidd et آل ، 1998 Seeger وآخرون ، 1993). (K) في جنين من النوع البري ، تعبر المحاور خط الوسط في المفصلين الأمامي (A) والخلفي (P) ، هنا تصور مع الجسم المضاد أحادي النسيلة BP102. (L) الإفراط في التعبير عن Myc DCas في جميع الخلايا العصبية في خلفية من النوع البري باستخدام إيلاف غال 4 سائق عند 29 درجة مئوية (+++) ، ينتج عنه عبور متزايد وغير طبيعي للمحاور الصوارية (السهام) وأيضًا وصلات طولية (L) رفيعة ومتقطعة. (M-P) فحص وصلات Fasciclin II معبرة ، إيجابية 1D4 ، وصلات طولية للجهاز العصبي المركزي في DCas تظهر طفرات GOF أن ، كما في DCas طفرات LOF ، الرابط الطولي الخارجي الموجب 1D4 يكون أرق في بعض المقاطع ، متقطع في البعض الآخر ، وفي بعض الحالات يندمج مع الحافظة الطولية المتوسطة 1D4 الموجبة. بالإضافة إلى ذلك ، وجدنا أن الوصلات الطولية ، والتي عادة ما تكون متباعدة بشكل متساوٍ على جانبي خط الوسط للجهاز العصبي المركزي ، غالبًا ما تتقارب عند حاجز خط الوسط المثير للاشمئزاز. لاحظنا كذلك أن محاور الوصلة الطولية الإنسي غالبًا ما تعبر بشكل شاذ وتعيد عبور خط الوسط للجهاز العصبي المركزي ، وأيضًا أن الوصلات الطولية الثلاثة يتم تجميعها في بعض الأحيان في حافظة واحدة. كما حدث توقف المحاور داخل الوصلات الطولية وعندما خرجت المحاور من الحبل العصبي البطني ، مما أدى إلى ظهور نتوءات غير طبيعية ممتدة بعيدًا عن الجهاز العصبي المركزي. وبالتالي، DCas ينتج عن GOF عيوبًا واسعة النطاق لتحديد مسار محور عصبي للجهاز العصبي المركزي ، ومعظمها يتوافق مع فرط التجميد. (M-P) على وجه الخصوص ، بعد التعبير العصبي المرتفع لـ Myc DCas (++ أو +++) ، تم تحفيز المحاور داخل الروابط الطولية الثلاثة الإيجابية 1D4 بشكل غير طبيعي مع بعضها البعض. تضمنت هذه العيوب غياب أو انقطاع المحاور داخل الوصلات الطولية الثالثة (M ، الأسهم) ، عبور غير طبيعي للمحاور في خط الوسط (M ، رأس السهم المفتوح) ، حزم محاور كبيرة غير طبيعية (NO ، أسهم صغيرة) ، وتوقف محاور مفرطة التصلب في الجهاز العصبي المركزي (O ، رأس السهم) أو المحيط (N ، P ، رؤوس الأسهم). أشرطة المقياس: 40 ميكرومتر في A 20 ميكرومتر في B 20 ميكرومتر في C ، لـ C ، D 6 ميكرومتر في F ، لـ FJ 13 ميكرومتر في K ، لـ K-L15 ميكرومتر في M ، لـ M-P.

    باشاو ، ج.ج.جودمان ، س. (1999). مستقبلات التوجيه المحوار الكيميري: تحدد المجالات السيتوبلازمية لمستقبلات الشق ومستقبلات النترين الجذب مقابل التنافر. زنزانة97, 917-926.

    بات ، م. (1993). الأديم المتوسط ​​ومشتقاته. في تطور ذبابة الفاكهة السوداء، (محرر M. Bate and A. Martinez-Arias) ، الصفحات 1013-1090. كولد سبرينج هاربور ، نيويورك: كولد سبرينج هاربور برس.

    Brower، D.L، Bunch، T. A.، Mukai، L.، Adamson، T. E.، Wehrli، M.، Lam، S.، Friedlander، E.، Roote، C.E and Zusman، S. (1995). المتطلبات غير المتكافئة لـ PS1 و PS2 إنتجرين في مرفقات الخلية في ذبابة الفاكهة: التحليل الجيني للوحدة الفرعية للإنتيجرين ألفا PS1. تطوير121, 1311-1320.

    Colville، T.، Hingorani، R.، Flores-Saaib، R.، Kosman، D.، Bier، E.، Campos، R.، Wilson، M.، Stall، A. and Voland، J.R. نهج البروتيوميات لتحديد الأجسام المضادة المضادة للإنسان عبر تفاعلية محددة لبروتينات ذبابة الفاكهة. www.bdbioscience.com/ملفات PDF/آخر/991A.pdf.

    Doe ، C.Q. ، Smouse ، D. and Goodman ، C. S. (1988). السيطرة على مصير الخلايا العصبية عن طريق تخطي جين تجزئة ذبابة الفاكهة. طبيعة سجية333, 376-378.

    هوانغ ، ب ، وتشيبا ، أ. (1998). التحليل الجيني لدور الإنتجرين أثناء توجيه المحور العصبي في ذبابة الفاكهة. J. نيوروسسي.18, 7847-7855.

    Kidd، T.، Brose، K.، Mitchell، K. J.، Fetter، R.D، Tessier-Lavigne، M.، Goodman، C.S and Tear، G. (1998). يتحكم الدوار في عبور محور عصبي للخط الوسط للجهاز العصبي المركزي ويحدد فصيلة فرعية جديدة من مستقبلات التوجيه المحفوظة تطوريًا. زنزانة92, 205-215.

    Kiehart، D. P. and Feghali، R. (1986). الميوسين السيتوبلازمي من ذبابة الفاكهة السوداء. J. خلية بيول.103, 1517-1525.

    Landgraf ، M. ، Bossing ، T. ، Technau ، G.M and Bate ، M. (1997). أصل وموقع وإسقاطات الخلايا العصبية الجنينية في البطن من ذبابة الفاكهة. J. نيوروسسي.17, 9642-9655.

    Landgraf ، M. ، Roy ، S. ، Prokop ، A. ، VijayRaghavan ، K. and Bate ، M. (1999). حتى تخطي يحدد النمو الظهري للمحاور الحركية في ذبابة الفاكهة. عصبون22, 43-52.

    ليبتين ، إم ، بوغارت ، ت. ، ليمان ، ر. وويلكوكس ، إم. (1989). وظيفة PS إنتغرينات أثناء التطور الجنيني ذبابة الفاكهة. زنزانة56, 401-408.

    ميلر ، سي أ ، وبينزر ، س. (1983). تفاعلات الأجسام المضادة أحادية النسيلة بين ذبابة الفاكهة والدماغ البشري. بروك. ناتل. أكاد. علوم. الولايات المتحدة الأمريكية80, 7641-7645.

    باتيل ، إن إتش ، شيفر ، بي ، جودمان ، سي إس وهولمغرين ، ر. (1989). دور جينات قطبية القطعة أثناء تكوين الخلايا العصبية ذبابة الفاكهة. تطوير الجينات.3, 890-904.

    بروكوب ، أ ، مارتن بيرمودو ، إم دي ، بات ، إم وبراون ، إن إتش. (1998). يؤثر غياب PSإنتجرينات أو لامينين أ على الالتصاق خارج الخلية ، ولكن ليس على التجمع داخل الخلايا ، لنصفي الدم والتقاطعات العصبية العضلية في أجنة ذبابة الفاكهة. ديف. بيول.196, 58-76.

    Qian، X.، Riccio، A.، Zhang، Y. and Ginty، D. D. (1998). تحديد وتوصيف ركائز جديدة لمستقبلات Trk في تطوير الخلايا العصبية. عصبون21, 1017-1029.

    Roote ، C.E and Zusman ، S. (1995). وظائف PS Integins في التصاق الأنسجة ، والهجرة ، وتغيرات الشكل أثناء التطور الجنيني المبكر في ذبابة الفاكهة. ديف. بيول.169, 322-36.

    Seeger ، M. ، Tear ، G. ، Ferres-Marco and Goodman ، C. S. (1993). الطفرات التي تؤثر على توجيه مخروط النمو في ذبابة الفاكهة: الجينات اللازمة للتوجيه نحو أو بعيدًا عن خط الوسط. عصبون10, 409-426.

    تيرمان ، جي آر ، وانج ، إكس إم ومارتن ، جي إف. (2000). إصلاح الحبل الشوكي المقطوع في مراحل مختلفة من التطور في أبوسوم أمريكا الشمالية ، ديدلفيس فيرجينيانا. Res الدماغ. ثور.53, 845-855.

    ثور ، س ، أندرسون ، س. ج ، توملينسون ، أ. وتوماس ، ج. ب. (1999). رمز اندماجي LIM-homeodomain لاختيار مسار العصب الحركي. طبيعة سجية397, 76-80.

    رايت ، تي آر. (1969). الوراثة الوراثية للميتوسفيرويد المميت الجنيني المتحور في D. melanogaster. ياء إكسب. زول.143, 77-99.


    شاهد الفيديو: عملية إنتاج البروتينات سر الحياة (شهر فبراير 2023).