معلومة

4.1: الطفرة وتعدد الأشكال - علم الأحياء

4.1: الطفرة وتعدد الأشكال - علم الأحياء


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد لاحظنا سابقًا أن الصفة المهمة للحمض النووي هي الدقة: ففي معظم الأحيان يمرر نفس المعلومات بدقة من جيل إلى آخر. التغييرات في تسلسل الحمض النووي تسمى الطفرات. إذا غيّرت الطفرة النمط الظاهري للفرد ، يُقال أن الفرد هو أ متحولة. تسمى أيضًا متغيرات التسلسل التي تحدث بشكل طبيعي ، ولكنها نادرة ، والتي تختلف بشكل واضح عن تسلسل النوع البري العادي ، الطفرات. وبالتالي ، فإننا نستخدم المصطلح تعدد الأشكال للإشارة إلى متغيرات تسلسل الحمض النووي (وأنماط ظاهرية أخرى) التي تتعايش في مجموعة سكانية بترددات عالية نسبيًا (> 1٪).

تنشأ تعدد الأشكال والطفرات من خلال عمليات كيميائية حيوية مماثلة ، لكن استخدام كلمة "تعدد الأشكال" يتجنب الإشارة إلى أن أي أليل معين يكون طبيعيًا أو غير طبيعي. على سبيل المثال ، التغيير في تسلسل الحمض النووي للشخص الذي يؤدي إلى مرض مثل السرطان يسمى بشكل مناسب طفرة ، ولكن الاختلاف في تسلسل الحمض النووي الذي يفسر ما إذا كان لدى الشخص شعر أحمر بدلاً من الشعر البني أو الأسود هو مثال على تعدد الأشكال. تعتبر الواسمات الجزيئية ، التي سنناقشها في الفصل التاسع ، نوعًا مفيدًا بشكل خاص من تعدد الأشكال لبعض مجالات البحث في علم الوراثة.


طرق تحديد متغيرات الحمض النووي للميتوكوندريا

كلوديا كالابريس. مارسيلا أتيمونيلي ، في جينوم الميتوكوندريا البشري ، 2020

11.2.2.1 تعدد أشكال التشكل أحادي الخيط

SSCP يسمح بالكشف المتزامن للعديد من المتغيرات الجينية في عدد كبير من العينات اعتمادًا على اختلافات التنقل الكهربي. كثيرًا ما يستخدم SSCP للكشف عن بدائل القاعدة أو عمليات الحذف الصغيرة أو عمليات الإدخال في الحمض النووي. يتم تغيير طبيعة شظايا تفاعل البوليميراز المتسلسل المسمى المشع والتي تبلغ حوالي 200-350 نقطة أساس ويتم فصل الخيوط المفردة عن طريق الرحلان الكهربي للهلام متعدد الأكريلاميد غير المشع. يتم الكشف عن طريق التغييرات في تنقل الحمض النووي [82]. تم أيضًا وصف SSCP معدل لتقييم تعدد الأشكال mtDNA باستخدام نظام رحلاني شبه آلي متبوعًا بتلطيخ الفضة [78]. ومع ذلك ، فإن هذه الطريقة ليست مفيدة للغاية لأنها تتطلب تأكيدًا تكميليًا عن طريق تسلسل الحمض النووي لتحديد المتغير ولديها حساسية منخفضة.


علم الوراثة الدوائية

الدوبامين وتعدد أشكال المستقبلات الأخرى

تعدد الأشكال الجينية في مستقبلات الدوبامين ارتبطت بالمسؤولية عن تعاطي المخدرات والتأثيرات المعززة للكحول والكوكايين والنيكوتين. ترتبط مستقبلات الدوبامين المتغيرة وراثيًا أيضًا بزيادة حدوث خلل الحركة المتأخر بعد العلاج طويل الأمد لمرض انفصام الشخصية باستخدام مضادات مستقبلات الدوبامين. إن الفصام بحد ذاته هو مجموعة معقدة من الأمراض التي لا تتم معالجتها بشكل كافٍ في العديد من المرضى. وفقًا لذلك ، تم العثور على كل من مضادات الذهان النموذجية وغير النمطية لتكون فعالة في بعض وليس كل مرضى الفصام. ارتبطت الأشكال الجينية المتعددة في أهداف مستقبلات الأدوية المضادة للذهان (الدوبامين ، الأدرينالي ، السيروتونين ، و / أو الأنواع الفرعية لمستقبلات الهيستامين) باستجابات سريرية مختلفة. قد تشكل مجموعات الأشكال المتعددة المستهدفة للأدوية ومتغيرات استقلاب الدواء أساسًا لاستهداف مجموعات فرعية وراثية من مرضى الفصام من أجل علاج فعال بمضادات الذهان النموذجية والأدوية الحديثة المضادة للذهان.


تعدد أشكال الحمض النووي: المعنى والفئات | علم الوراثة

في هذه المقالة سوف نناقش حول معنى فئات من تعدد أشكال الحمض النووي.

معنى تعدد أشكال الحمض النووي:

تنتج الأليلات المختلفة للجين أنماطًا ظاهرية مختلفة يمكن اكتشافها عن طريق إجراء تهجين بين الآباء الذين لديهم أليلات مختلفة لجينين أو أكثر. ثم عن طريق تحديد المؤتلفات في النسل ، يمكن استنتاج الخريطة الجينية.

هذه خرائط جينية منخفضة الدقة تحتوي على جينات ذات تأثيرات نمطية يمكن ملاحظتها ، وكلها تم تعيينها إلى مواقعها الخاصة. يمكن العثور على موضع جين أو موضع معين من الخريطة. ومع ذلك ، أظهرت القياسات أن الفواصل الصبغية بين الجينات المعينة ستحتوي على كميات هائلة من الحمض النووي.

لا يمكن تعيين هذه الفواصل الزمنية بواسطة طريقة النسل المؤتلف لأنه لا توجد علامات في تلك المناطق المتداخلة. أصبح من الضروري إيجاد علامات تفاضلية إضافية أو اختلافات جينية تقع في الفجوات. تم تلبية هذه الحاجة من خلال استغلال مختلف واسمات الحمض النووي متعددة الأشكال.

تعدد أشكال الحمض النووي هو تباين في تسلسل الحمض النووي لا يرتبط بأي اختلاف ظاهري يمكن ملاحظته ، ويمكن أن يوجد في أي مكان في الجينوم ، وليس بالضرورة في الجين. يعني تعدد الأشكال واحدًا من شكلين أو أكثر من الأشكال البديلة (الأليلات) لمنطقة صبغية تحتوي إما على تسلسل نيوكليوتيدات مختلف ، أو تحتوي على أعداد متغيرة من النيوكليوتيدات المتكررة بالترادف.

وبالتالي ، فهو موقع تغاير الزيجوت لأي اختلاف في التسلسل. العديد من الأشكال المتعددة للحمض النووي مفيدة لدراسات رسم الخرائط الجينية ، ومن ثم يشار إليها باسم علامات الحمض النووي. يمكن الكشف عن علامات الحمض النووي على تهجين اللطخة الجنوبية أو عن طريق تفاعل البوليميراز المتسلسل.

أليلات علامات الحمض النووي هي المسيطرة المشتركة ، أي أنها ليست سائدة ولا متنحية كما لوحظ في أليلات معظم الجينات. تشكل الأشكال المتعددة للحمض النووي اختلافات محددة جزيئيًا بين البشر.

فئات تعدد أشكال الحمض النووي:

هناك بعض الفئات الرئيسية لتعدد أشكال الحمض النووي.

1. تعدد أشكال النوكليوتيدات المفردة:

SNP هو تغيير زوج أساسي واحد ، وطفرة نقطية ، ويشار إلى الموقع باسم SNP locus. تعد SNPs هي النوع الأكثر شيوعًا من تعدد أشكال الحمض النووي ، وتحدث بتردد واحد من 350 زوجًا أساسيًا ، وتمثل أكثر من 90 في المائة من تباين تسلسل الحمض النووي. تم العثور على غالبية SNPs موجودة في المناطق غير المشفرة من الجينوم ، والمعروفة باسم SNPs غير المشفرة. تُعرف SNPs في مناطق الترميز ، داخل الجينات ، باسم SNPs الترميز (cSNPs).

تشير الدراسات التفصيلية لـ cSNPs في البشر إلى أن كل جين يحتوي على حوالي أربعة cSNPs ، ينتج نصفها طفرات مغلوطة في البروتين المشفر ، وينتج نصفها طفرات صامتة. ما إذا كان cSNP يؤثر على النمط الظاهري ، يعتمد على الحمض الأميني الذي يتغير بواسطة تعدد الأشكال.

يُقدر أن حوالي نصف الطفرات الخاطئة التي هي تعدد أشكال النيوكليوتيدات SNPs تسبب أمراضًا وراثية في البشر. يمكن أن يؤثر SNP غير المشفر أيضًا على وظيفة الجين إذا كان موجودًا في منطقة المروج أو في منطقة تنظيم الجينات. يمكن لعدد صغير من SNPs إنشاء موقع تقييد ، أو إزالة موقع تقييد موجود بالفعل. تم الكشف عن التغييرات التي يسببها SNP في مواقع التقييد باستخدام إنزيم التقييد متبوعًا بتحليل اللطخة الجنوبية أو PCR.

يمكن تحليل موضع SNP الفردي باستخدام تقنية تهجين قليل النوكليوتيد الخاص بالأليل (ASO). يُعد البحث عن موضع معين في النوكليوتيدات SNP في البشر تحديًا ، لأن هذا زوج أساسي واحد متعدد الأشكال من أصل ثلاثة مليارات زوج أساسي في الجينوم البشري.

في تقنية ASO ، يتم تصنيع قليل النوكليوتيد قصير مكمل لأليل SNP واحد وخلطه مع الحمض النووي المستهدف. يتم إجراء التهجين في ظل ظروف شديدة الصرامة تسمح فقط بمطابقة كاملة بين المسبار والحمض النووي المستهدف. وهذا يعني أن قليل النوكليوتيد لن يتهجين مع الحمض النووي المستهدف الذي يحتوي على أي أليل SNP آخر في هذا الموضع. تشير النتيجة الإيجابية للتهجين إلى موضع SNP بدقة.

يمكن استخدام تقنية أحدث من المصفوفات الدقيقة للحمض النووي للطباعة المتزامنة لمئات أو الآلاف من تعدد الأشكال. تفاصيل هذه التقنية المستخدمة في تعدد الأشكال والتعبير الجيني الواسع موصوفة لاحقًا في هذا القسم.

يمكن أن يؤدي عدد صغير من SNPs إلى تغييرات في مواقع التقييد إما عن طريق إنشاء موقع تقييد أو حذف موقع. يمكن الكشف عن هذه النيوكلوتايد باستخدام إنزيم التقييد للموقع ، ويتم الكشف عن طريق تحليل اللطخة الجنوبية أو تفاعل البوليميراز المتسلسل. تؤدي الأنماط المختلفة لمواقع التقييد في الجينومات المختلفة إلى أجزاء من أطوال مختلفة ، تسمى تعدد أشكال طول جزء التقييد (RFLPs) الموضحة أدناه.

2. تقييد طول جزء تعدد الأشكال:

RFLPs هي مواقع للتعرف على الإنزيمات المقيدة الموجودة في بعض الجينومات وغائبة في البعض الآخر. ضع في اعتبارك كائنًا حيويًا متغاير الزيجوت من أجل RFLP الذي نمثل تركيبه الوراثي كـ Rr. يتم تهجين هذا الكائن الحي مع كائن آخر متماثل لأليل التباين RFLP (rr). الحمض النووي الجينومي من ذرية هذا التهجين (Rr x rr يعطي ذرية 50٪ منها Rr و 50٪ rr) يخضع لهضم إنزيم مقيد ، وشظايا منفصلة على بقع جنوبية.

يتم تهجين شظايا التقييد التي تم الحصول عليها باستخدام مسبار (جزء مستنسخ من الحمض النووي) يميز الأنماط الجينية المختلفة لـ RFLP. يعتبر الحمض النووي للمسبار فريدًا لأنه يأتي من جزء DNA واحد فقط من الجينوم والذي يتداخل مع موقع التقييد. وبالتالي ، فإن النقطة الأساسية في هذه التقنية هي استخدام مسبار DNA نسخة واحدة مستنسخة محددة لموضع محدد فردي.

قد تؤدي عمليات التهجين بين كائن RFLP الإيجابي مع الكائنات الحية الأخرى التي تحمل RFLP إلى توليفات الوالدين وإعادة التوليفات. من تواتر المواد المؤتلفة ، يمكن إنتاج خريطة RFLP مفصلة. كانت RFLPs هي علامات الحمض النووي الأولى التي تم استخدامها لتوصيف الجينوم النباتي والحيواني. تم استبدالها الآن بعلامات بناءً على التباين في عدد التكرارات الترادفية القصيرة (STRs) الموضحة أدناه.

3. التكرارات الترادفية القصيرة:

تُعرف المعاملات المشبوهة أيضًا باسم السواتل الدقيقة وتكرار التسلسل البسيط (SSRs). التكرار الترادفي هو تسلسل يتكرر من النهاية إلى النهاية في نفس الاتجاه. وتتألف المعاملات المشبوهة من 2 إلى 6 تتابعات DNA زوج قاعدية تتكرر جنبًا إلى جنب عدة مرات.

على سبيل المثال ، التسلسل TCACATCACATCACATCACATCACA هو تكرار خمسة أضعاف لتسلسل TCACA. هناك ثنائي النوكليوتيدات ، ثلاثي النوكليوتيدات ، أربعة نيوكليوتيدات ، خمسة نيوكليوتيدات وستة نيوكليوتيدات في الجينوم البشري.

يمكن إجراء تحليل الأقمار الصناعية الدقيقة باستخدام DNA من نسخة واحدة ليكون بمثابة زوج تمهيدي PCR محدد لكل موضع محدد. على النقيض من RFLPs التي تحتوي على أليلات واحدة أو اثنتين فقط في المجتمع ، تحتوي تقارير المعاملات المشبوهة على عدد أكبر بكثير من الأليلات التي يمكن اكتشافها في تحليل السكان.

وبالتالي ، تحتوي تقارير المعاملات المشبوهة على نسبة أعلى من الزيجوت المتغاير مما يجعلها أكثر ملاءمة لأغراض رسم الخرائط. تعد الأشكال المتعددة في تقارير المعاملات المشبوهة شائعة بين السكان مما يجعلها أدوات قيمة في رسم الخرائط الجينية.

4. عدد متغير يتكرر جنبا إلى جنب:

VNTRs ، التي تسمى أيضًا علامات الأقمار الصناعية الصغيرة ، تكون وحدة التكرار أكبر قليلاً مما هي عليه في STR ، من سبعة إلى بضع عشرات من أزواج القاعدة. يتراوح موقع VNTR في البشر من 1 إلى 5 كيلو متواليات قاعدية تحتوي على وحدات متكررة يبلغ طولها حوالي 15 إلى 100 نيوكليوتيد. تُظهر مواقع VNTR أيضًا تعدد الأشكال. نظرًا للطول الأكبر لتكرار VNTR الذي يجعل PCR غير مناسب ، يعتمد تحليل VNTR على الهضم المقيد والنشاف الجنوبي.

يتم قطع الحمض النووي الجينومي بأكمله باستخدام إنزيم التقييد الذي يقطع على جانبي موضع VNTR ، ولكن ليس له موقع مستهدف داخل مصفوفات VNTR ، متبوعًا بالنشاف الجنوبي. سوف يرتبط مسبار VNTR المحدد مقابل تسلسل تكرار معين لموضع VNTR في جميع مواقع تسلسل التكرار في الجينوم ، مما ينتج عنه عدد كبير من الأجزاء ذات الأحجام المختلفة.

عدد التكرارات الترادفية متغير من فرد إلى آخر ، وبالتالي فإن اللطخة الجنوبية توفر نمطًا مميزًا مميزًا للشظايا لفرد واحد. يشار إلى هذه الأنماط أيضًا باسم بصمات الحمض النووي. تجد هذه التقنية تطبيقًا مفيدًا في تحديد الأفراد وفي تحديد النسب.

5- علامات السواتل الدقيقة:

تتناثر في الجينوم أعداد متغيرة من ثنائي النيوكليوتيدات تتكرر جنبًا إلى جنب ، تسمى محددات الأقمار الصناعية الدقيقة. النوع الأكثر شيوعًا هو CA وتكرار GT التكميلي. تم تصميم المجسات للكشف عن مناطق الحمض النووي المحيطة بتكرار الأقمار الصناعية الدقيقة الفردية باستخدام PCR.

يتم شرح الإجراء بأخذ مثال الحمض النووي البشري على النحو التالي. يخضع الحمض النووي الجيني البشري لعملية هضم محدودة بواسطة إنزيم مثل Alu l ، مما ينتج عنه شظايا يبلغ طولها حوالي 400 زوج قاعدي. يتم استنساخ الشظايا في ناقل ويتم إجراء النشاف الجنوبي.

لتحديد الإدخالات الجينومية التي تحتوي على نيوكليوتيدات CA / GT ، يتم استخدام مجسات خاصة لهذه النيوكليوتيدات. يتم تحديد تسلسل الحيوانات المستنسخة الإيجابية ، على أساس تصميم بادئات PCR التي من شأنها التهجين مع تسلسلات DNA أحادية النسخة التي تحيط بتسلسلات الأقمار الصناعية الدقيقة المتكررة بشكل مترادف. يتم إجراء تضخيم PCR باستخدام أزواج التمهيدي والحمض النووي الجيني.

وبالتالي ، إذا كان أي اختلاف في الحجم موجودًا في امتداد تسلسل الأقمار الصناعية الصغيرة المتكرر بالترادف ، فسيتم اكتشافه من خلال الرحلان الكهربائي للهلام للحمض النووي من أفراد مختلفين. قد تختلف الاختلافات في الحجم بين الأفراد المختلفين ، ويمكن تحديد كل هذه الاختلافات. ينتج عن اختلاف الحجم منتج تضخيم بحجم مختلف ويمثل أليل علامة.

6. الحمض النووي متعدد الأشكال المضخم عشوائياً:

تعتمد RAPD على التضخيم العشوائي PCR. يتم تنفيذ الإجراء عن طريق التصميم العشوائي للبادئات لـ PCR والتي ستضخم عدة مناطق مختلفة من الجينوم عن طريق الصدفة. ينتج عن مثل هذا التمهيدي تضخيم مناطق الحمض النووي الموجودة بالقرب منها فقط ، والنسخ المقلوبة من التسلسل التمهيدي الخاص به.

تتكون منتجات PCR من نطاقات DNA تمثل أحجامًا مختلفة من الحمض النووي المضخم. تسمى مجموعة شظايا الحمض النووي المتضخمة بالحمض النووي المضخم عشوائياً متعدد الأشكال (RAPD). قد تكون نطاقات معينة فريدة من نوعها للفرد ويمكن أن تكون بمثابة علامات الحمض النووي في تحليل رسم الخرائط.


علم الوراثة

تعدد الأشكال الجيني

نظرًا لأن كل تعدد الأشكال له أساس وراثي ، تعدد الأشكال الجيني له معنى خاص:

  • تعدد الأشكال الجيني هو الحدوث معًا في نفس المنطقة لنوعين أو أكثر من الأشكال غير المستمرة من الأنواع بنسب لا يمكن الحفاظ على أندرها فقط عن طريق الطفرة المتكررة [5]. يطلق عليه أحيانًا الاختيار المتوازن ، ويرتبط ارتباطًا وثيقًا بفكرة ميزة الزيجوت المتغاير.

يتألف التعريف من ثلاثة أجزاء: أ) التعاطف: مجتمع متزاوج واحد ب) أشكال منفصلة و ج) لا يتم الحفاظ عليه بالطفرة فقط.

تعدد التوجهات

معظم الجينات لها أكثر من تأثير واحد على النمط الظاهري للكائن الحي (تعدد التوجهات). قد تكون بعض هذه التأثيرات مرئية ، وبعضها الآخر خفي ، لذلك من المهم غالبًا النظر إلى ما وراء التأثيرات الأكثر وضوحًا للجين لتحديد التأثيرات الأخرى. تحدث الحالات التي يؤثر فيها الجين على شخصية مرئية غير مهمة ، ومع ذلك يتم تسجيل تغيير في اللياقة. في مثل هذه الحالات ، قد تكون التأثيرات الأخرى (الخفية أو الفسيولوجية) للجين مسؤولة عن التغيير في اللياقة.
"إذا كانت السمة المحايدة مرتبطة بشكل متعدد الاتجاهات بسمة مفيدة ، فقد تظهر بسبب عملية الانتقاء الطبيعي. وقد تم اختيارها ولكن هذا لا يعني أنها تكيف. والسبب هو أنه على الرغم من اختيارها ، فقد كان هناك لا يوجد اختيار لهذه السمة ". [13]

رعاف

يحدث التعرق عندما يتم تعديل التعبير عن جين بواسطة جين آخر. على سبيل المثال ، يظهر الجين A تأثيره فقط عند وجود الأليل B1 (في موضع آخر) ، ولكن ليس في حالة وجود B2. هذه إحدى الطرق التي يمكن أن يتحد بها جينان أو أكثر لإنتاج تغيير منسق في أكثر من حرف واحد (في ، على سبيل المثال ، التقليد). على عكس الجينات الفائقة ، لا تحتاج الجينات المعرفية إلى الارتباط الوثيق أو حتى على نفس الكروموسوم.

يُظهِر كل من تعدد التوجهات والنقمة أن الجين لا يحتاج إلى الارتباط بشخصية بالطريقة البسيطة التي كان يُفترض في السابق.

أصل الجينات الفائقة

على الرغم من أنه يمكن التحكم في تعدد الأشكال بواسطة الأليلات في موضع واحد (مثل مجموعات الدم ABO البشرية) ، يتم التحكم في الأشكال الأكثر تعقيدًا بواسطة عدة جينات مرتبطة بإحكام على كروموسوم واحد. يعد التقليد الباتيسي في الفراشات والتباين في كاسيات البذور أمثلة جيدة. هناك نقاش طويل الأمد حول كيفية نشوء هذا الوضع ، ولم يتم حل السؤال بعد.

في حين أن عائلة الجينات (عدة جينات مرتبطة ارتباطًا وثيقًا تؤدي وظائف متشابهة أو متطابقة) تنشأ عن ازدواج جين أصلي واحد ، فإن هذا ليس هو الحال عادةً مع الجينات الفائقة. في الجين الفائق ، تمتلك بعض الجينات المكونة وظائف متميزة تمامًا ، لذلك يجب أن تكون قد اجتمعت معًا تحت الانتقاء. قد تتضمن هذه العملية قمع العبور ، وانتقال شظايا الكروموسوم وربما تكرار الكيسترون العرضي. يمكن قمع هذا العبور عن طريق الاختيار معروف منذ سنوات عديدة. [14] [15]

تميل الجدل إلى التركيز على السؤال ، هل يمكن أن تبدأ الجينات المكونة في الجين الفائق في كروموسومات منفصلة ، مع إعادة تنظيم لاحقة ، أم أنه من الضروري أن تبدأ على نفس الكروموسوم؟ في الأصل ، اعتبر أن إعادة ترتيب الكروموسوم سيلعب دورًا مهمًا. [16] تم قبول هذا التفسير من قبل E.B. فورد ودمجها في حساباته عن علم الوراثة البيئية. [17] [18]

ومع ذلك ، يعتقد الكثيرون اليوم أنه من المرجح أن تبدأ الجينات على نفس الكروموسوم. [19] يجادلون بأن الجينات الفائقة قد نشأت فى الموقع. يُعرف هذا بفرضية غربال تيرنر. [20] وافق ماينارد سميث على هذا الرأي في كتابه المدرسي الموثوق ، [21] لكن السؤال لا يزال غير محسوم بشكل نهائي.


الطفرة مقابل تعدد الأشكال - الطفرة مقابل تعدد الأشكال (أبريل / 05/2006)

إنه سؤال قديم ولكن لا يبدو أنه يجد إجماعًا من حيث الإجابة. أود أن أسمع ما هو التعريف الحقيقي للطفرة مقابل تعدد الأشكال.

أحتاج إلى التحقق من فهمي. وإذا كنت مخطئا ، يمكنني تصحيح ذلك.

نعم كلاهما تغير ولكن من الأصدق شرح ذلك على أنهما
طفرة: تحدث من خارج الخلية: بواسطة عامل خارجي ، وراثي و
لا يضر بالضرورة المضيف. لذلك فإن الطفرة فردية و
لذلك يحدث في أقل من 1٪ من السكان.

تعدد الأشكال: يحدث من داخل الخلية (أي من خلال التطور تتغير الخلية لتتوافق
إلى البيئة المتغيرة من أجل البقاء. (بعد كل الوظيفة الأساسية للخلية هي
استخدام جميع مساراتها وآلياتها المختلفة للبقاء وبالتالي الحفاظ عليها
وظيفتها داخل العائل.)) قابلة للتوريث ولكنها ليست بالضرورة ضارة لـ
مضيف. سيحدث هذا التغيير الموروث في 1 ٪ على الأقل من السكان.

إذا كان لابد من إعطاء أمثلة ، فما هي الأمثلة التي سيتم تصنيفها تحت الطفرات وأيها تحت تعدد الأشكال.

التفسير الذي قدمته هو أن الطفرة تسبب المرض في حين أن تعدد الأشكال لا يسبب ذلك.

أنا لا أتفق معك تمامًا على هذه هيلينا. ربما يعتمد ذلك على النوع الذي تعمل عليه ، لكنني أعمل على فيروس RNA بخطوة نسخ عكسي في دورة حياته. لا يوجد لدى RT أي نشاط تدقيق ، لذلك هناك الكثير من الاقتباسات العشوائية والاقتباسات.

الشيء هو أنه نظرًا للتنوع الكبير في جينومها ، فقد تم تصنيفها إلى أنواع فرعية (إنها مجموعة HIV-1 M التي نتحدث عنها). كما تعلم ، هناك بعض المركبات المضادة للفيروسات القهقرية المستخدمة في علاج المصابين بفيروس نقص المناعة البشرية. دون الخوض في التفاصيل ، ستحصل هذه الفيروسات لدى هؤلاء الأفراد على طفرات من شأنها أن تجعل الفيروس أقل عرضة لبعض الأدوية (سبب فشل العلاج). الآن ، بالنسبة لطفرات معينة ، من المعروف أنها تحدث فقط & quot؛ ناتجة & quot؛ بسبب العلاج في أنواع فرعية معينة ولكنها موجودة في كل مكان في أنواع فرعية أخرى (ومن ثم فهي ضمن هذا النوع الفرعي تسميات & quot؛ تعدد الأشكال & quot).

الطفرة أشبه بالحدث. إنه شيء يحدث ويغير الجينوم ، وعادة ما يمر دون أن يلاحظه أحد ، وأحيانًا يتسبب في مرض ونادرًا ما يمنح ميزة انتقائية ويغير التطور.

يشير تعدد الأشكال إلى اختلاف في الجينوم في نوع واحد. أعتقد أنه في الواقع يجب أن يحدث مثل هذا الاختلاف بنسبة 1 ٪ على الأقل داخل مجموعة سكانية. كما هو الحال مع الطفرات ، قد تمر دون أن يلاحظها أحد ، ولكن عادة ما يكون لها تأثيرات صغيرة على الأنماط الظاهرية: ليس بقدر الطفرات. على سبيل المثال ، لون الشعر ، فعالية الإنزيم ، مستقبلات HLA ، جميع أنواع الأشياء. قد يؤهبون للأمراض ، مثل APOE (؟) ومرض الزهايمر.

لا أعتقد أن مصدر التغيير الجيني (خارجي أو داخلي المنشأ) له علاقة به.

الطفرة أشبه بالحدث. إنه شيء يحدث ويغير الجينوم ، وعادة ما يمر دون أن يلاحظه أحد ، وأحيانًا يتسبب في مرض ونادرًا ما يمنح ميزة انتقائية ويغير التطور.

يشير تعدد الأشكال إلى اختلاف في الجينوم في نوع واحد. أعتقد أنه في الواقع يجب أن يحدث مثل هذا الاختلاف بنسبة 1 ٪ على الأقل داخل مجموعة سكانية. كما هو الحال مع الطفرات ، قد تمر دون أن يلاحظها أحد ، ولكن عادة ما يكون لها تأثيرات صغيرة على الأنماط الظاهرية: ليس بقدر الطفرات. على سبيل المثال ، لون الشعر ، فعالية الإنزيم ، مستقبلات HLA ، جميع أنواع الأشياء. قد يؤهبون للأمراض ، مثل APOE (؟) ومرض الزهايمر.

لا أعتقد أن مصدر التغيير الجيني (خارجي أو داخلي المنشأ) له علاقة به.

أتفق مع ديفيد ، الطفرة هي حدث يحدث مرة واحدة في فرد واحد ، إما بسبب مصدر خارجي (مادة كيميائية أو إشعاعية أو أي شيء آخر) أو لمجرد خطأ في التكرار. بعد ذلك ، إذا كانت هذه الطفرة موروثة ، فقد تنتشر في المجتمع (بصرف النظر عن حقيقة أن لها تأثير على النمط الظاهري أم لا). ثم يمكن اعتباره تعدد الأشكال. أود أن أقول أن الطفرة هي الحدث وأن تعدد الأشكال هو نتيجة هذا الحدث. لا أعرف ما إذا كنت واضحًا.
فاليري

تعدد الأشكال هو طفرة تم إثبات أن لها ميزة أعلى من نسبة مئوية معينة في مجموعة سكانية معينة

الطفرة هي تغيير من القاعدة / المرجع ، وتعدد الأشكال هو معيار مستثنى.
تعد الأشكال المتعددة وراثيا منتشرة عبر السلالة الجرثومية عن طريق الانتقاء أو الانجراف الجيني ، بينما الطفرات ليست مضطرة لذلك.

القواميس ليست واضحة حول هذه النقطة. يعرّف البعض الطفرة على وجه التحديد على أنها تغير جيني وراثي ناتج عن طفرة ، أي عامل خارجي مثل الإشعاع أو المواد الكيميائية. البعض الآخر أكثر عمومية ويعرفه فقط على أنه تغيير جيني وراثي ناتج عن عوامل خارجية (مطفرة) أو أحداث داخلية مثل أخطاء النسخ ، والعبور غير المتكافئ ، وتحويل الجينات ، وما إلى ذلك. يبدو لي أن تعدد الأشكال مصطلح أكثر عمومية يعني ببساطة & quotmany Forms & quot ، كما يوحي الاسم & quot ؛ أشكال متعددة & quot. يعرّف قاموسي الداخلي الشخصي الطفرة على أنها حدث ، سواء كانت طفرة نقطية ، أو حذف ، أو إدخال ، أو انعكاس ، أو تكرار ، أو أي شيء ، يحدث مرة واحدة في الفرد ثم يختفي إذا لم يتكاثر هذا الفرد ، أو يزداد تكراره في السكان من خلال الانتقاء أو الانجراف الجيني المحايد. تعدد الأشكال هو ببساطة حالة الأشكال المتعددة. لذا ، فإن الطفرات هي أحداث تولد تعدد الأشكال.

ولكن هل يمكن اعتبار إعادة التركيب ، التي يمكن أن تولد أليلات جديدة للجين وبالتالي تعدد أشكال ذلك الجين ، حدثًا طفريًا؟ لا أعتقد ذلك. لذلك ربما تكون الطفرة مصدرًا واحدًا فقط لتعدد الأشكال.


أعراض ومسببات المرض العقلي الخطير

كارلوس دبليو برات ،. ميليسا م.روبرتس ، في إعادة التأهيل النفسي (الطبعة الثالثة) ، 2014

تعد الأشكال المتعددة للنيوكليوتيدات المفردة ، والتي يطلق عليها غالبًا SNPs (تُنطق "قصاصات") ، أكثر أنواع الاختلاف الجيني شيوعًا. يمثل كل SNP اختلافًا في لبنة بناء DNA واحدة ، تسمى "نوكليوتيد". على سبيل المثال ، قد يحل SNP محل النيوكليوتيدات السيتوزين (C) بالنيوكليوتيدات الثايمين (T) في امتداد معين من الحمض النووي. تحدث النيوكلوتايد بشكل طبيعي في جميع أنحاء الحمض النووي للشخص. تحدث مرة واحدة في كل 300 نيوكليوتيد في المتوسط ​​، مما يعني أن هناك ما يقرب من عشرة ملايين SNPs في الجينوم البشري. الأكثر شيوعًا ، توجد هذه الاختلافات في الحمض النووي بين الجينات. يمكن أن تعمل كواسمات بيولوجية ، تساعد العلماء على تحديد الجينات المرتبطة بالمرض. عندما تحدث SNPs داخل جين أو في منطقة تنظيمية بالقرب من الجين ، فقد تلعب دورًا مباشرًا أكثر في المرض من خلال التأثير على وظيفة الجين.


4.1: الطفرة وتعدد الأشكال - علم الأحياء

خلال الجزء الأول من القرن العشرين بعد إعادة اكتشاف علم الوراثة المندلي ، كانت الصورة المقبولة للجينوم هي أن معظم الكائنات الحية ، في أي موضع جيني معين ، متماثلة اللواقح لأليل واحد سائد ، يتوافق نمطه الظاهري مع "النوع البري" "القاعدة بالنسبة للأنواع ، والتي يتم مشاركتها مع أعضاء نموذجيين آخرين من نفس النوع. وفقًا لهذا الرأي ، نشأ متغير النمط الظاهري العرضي النادر كطفرة ، اعتُبرت الغالبية العظمى منها متنحية وضارة. على سبيل المثال ، معظم ذبابة الفاكهة لديها عيون حمراء: الذبابة ذات العين البيضاء النادرة كانت تعتبر متحولة ("متغيرة") نشأت نتيجة طفرة ("تغيير") في الجين.

في البشر ، تؤدي العديد من سمات الجين الواحد التي يسهل التعرف عليها إلى حالات طبية مثل المهق (عدم وجود صبغة الجلد) ، وتعدد الأصابع (الأصابع الإضافية) ، والودانة (نمو الأطراف المتوقفة) ، وما إلى ذلك ، وكلها نميل إلى وضعها في فئة "الأمراض". وبالتالي فإننا نميل إلى التفكير في هؤلاء الأفراد النادرين على أنهم "متحورون" وبالتالي "غير عاديين" ، على عكس غالبية السكان الذين (مثلنا) "طبيعيون". نميل إلى ربط المتغيرات الجينية بالمرض ، وننظر إلى "الطفرة" على أنها سلبية. كل هذه التصورات تبين أنها غير دقيقة. أظهرت التطورات في علم الأحياء الجزيئي منذ أواخر الستينيات بدلاً من ذلك قدرًا هائلاً من التباين الجيني في معظم الأنواع ، بما في ذلك الأنواع التي نعيشها. على مستوى تسلسل الحمض النووي ، من المحتمل أن يكون كل شخص تقريبًا متغاير الزيجوت في معظم مواضع الجينات ، ومن المرجح (باستثناء الأقارب المقربين) أن يختلف عن غيره من السكان. ولما كان الأمر كذلك ، فإن مفهوم "النوع البري" القياسي كـ "عادي"ليس لها معنى. تحدث الاختلافات الجينية الملحوظة مثل تعدد الأشكال أحادي النوكليوتيدات (SNPs) ، واختلافات زوج القاعدة البديل في مواضع معينة في تسلسل الجينات. التأثير المتغير لمثل هذا الاختلاف في SNP على الأنماط الظاهرية هو أحد موضوعات هذه الدورة. الحالة التي تؤدي فيها العديد من المتغيرات الجينية إلى ظروف طبية ضارة ، ويتم استثمار قدر كبير من الوقت والمال والبحث لفهم هذه الظروف وتحسينها.

في الاستخدام الحديث ، نتجنب استخدام كلمة "متحولة" للإشارة إلى الأفراد ("الملكة فيكتوريا كانت متحولة!") ، على الرغم من أننا قد نتحدث عن "الذباب الطافرة". نقيد أيضًا مصطلح "الطفرة" لوصف العملية الجزيئية التي يتم من خلالها إنتاج المتغيرات الجينية (" بيلة الفينيل كيتون النتائج من طفرة في الهيئة العامة للإسكان locus ") ، أو لتمييز متغير تسلسل نشأ حديثًا (" طفرة في موقع لصق "). تؤدي طفرة الحمض النووي إلى ظهور تباين SNP داخل السكان ، ومع ذلك ، من المحتمل أن تكون الاختلافات الملحوظة في SNP بين أي شخصين قد نشأت على الأقل عدة (وربما العديد ) أجيال سابقة في أسلافهم ، وليس نتيجة طفرة في الأمشاج الأبوية. الحالات النادرة هي المتغيرات الجينية التي لوحظت في الأقارب ، والتي يمكن غالبًا تتبعها إلى حدث طفري معين في سلف مشترك. على سبيل المثال ، الهيموفيليا في نسل الملكة فيكتوريا ناتج عن طفرة في الخلايا الجرثومية لها يُنظر إليها على أنها أ SNP في أحفادها (الذكور). [بقدر ما يمكن تحديده ، فإن الطفرة الأصلية في الملكة فيكتوريا قد انقرضت].

أدى القبول الواعي أو اللاواعي للمواقف غير الدقيقة حول "ما هو طبيعي" فيما يتعلق بالتنوع الجيني إلى سياسة اجتماعية مضللة ، مع عواقب وخيمة. تم تقديم مصطلح "تحسين النسل" في أواخر القرن التاسع عشر (قبل أي معرفة بعلم الوراثة) لوصف الجهود المبذولة لتحسين النوع البشري من خلال تشجيع تكاثر الأشخاص الذين لديهم "جينات جيدة" ، كما يتضح من الذكاء الفائق ، والصحة العامة ، والمجتمع المناسب. حالة أو لون جلد (أفتح) ، إلخ. في حالة عدم وجود أي معرفة بالوراثة ، كانت ممارسات "تحسين النسل الإيجابية" المبكرة هي ممارسات تربية الماشية ، على سبيل المثال ، الذي - التي مثل يلد مثل"وأشخاص"مخزون جيديجب تشجيعهم على التكاثر مع الآخرين مثلهم والأمل في الأفضل.

مع إعادة اكتشاف مندلعمل على الميراث في البازلاء ، افترض العديد من العلماء أن الاختلاف في أي سمة تقريبًا ("شخصية الوحدة") على أنه نتيجة وراثة جين واحد مندل. على سبيل المثال ، كلفت البحرية الأمريكية في عام 1919 بدراسة مكتب سجلات تحسين النسل على علم الوراثة "القدرة على القيادة"و" حب البحر "(thallasophilia) ، وذلك لتوفير وسيلة لاختيار طلاب البحرية على أساس أصولهم. ليس من المستغرب ،"قيادة"تم العثور عليها لتكون مسيطرة ، و"شهوة البحر'متنحية ومحدودة الجنس ، مثل نمو اللحية (هل رأيت سيدة أميرال؟). أظهرت الكتب المدرسية أنساب عائلة JS Bach لإثبات وراثة القدرة الموسيقية ، كما يتضح من ذريته الموهوبة المتعددة. منحت معارض الولاية شرائط زرقاء لـ "العائلات المناسبة" التي لديها أطفال أقوياء وأصحاء ، تمامًا مثل الماشية المتفوقة. تخلط هذه الجهود بين الوراثة والعائلة ، وميل أفراد الأسرة إلى التشابه مع بعضهم البعض بسبب بيئتهم المشتركة. على سبيل المثال ، غالبًا ما يتبع الأولاد آبائهم في وظائف البحرية والجيش ، وتلقى أطفال باخ دروسًا في الموسيقى من أبي.

لسوء الحظ ، كان لعلم تحسين النسل جانبه المظلم. الخسائر الهائلة من الحرب العالمية الأولى كان ينظر إليها في بعض الدول الغربية على أنها لها عواقب "تحسين النسل السلبية" ، حيث كان الضباط والجنود القتلى يميلون إلى أن يكونوا صغارًا ، يتمتعون بلياقة بدنية ، وذكورًا إنجابيًا يتمتعون بذكاء فائق ، تاركين وراءهم أولئك غير المؤهلين للخدمة العسكرية للقيام بالتكاثر. خلصت دراسات أُجريت على عائلات "ضعيفة التفكير" و (أو) "إجرامية" سيئة السمعة (ولا سيما عائلة كاليكاك) إلى أن هذه الصفات تتوارث في العائلات ، كما هو متوقع بالنسبة للسمات الوراثية ، وتتجاهل مرة أخرى آثار الفقر الأسري ، وسوء التغذية ، والوصم الاجتماعي ( وعادة ما يتم نبذ أطفال "كاليكاك").

عززت شعبية التفكير في تحسين النسل المشاعر المعادية للمهاجرين بعد الحرب العالمية الأولى في الولايات المتحدة وكندا. مع إدخال اختبارات الذكاء بالنسبة للتتبع التعليمي ، تُعزى الدرجات المنخفضة من المهاجرين الجدد إلى ضعف جيناتهم الوراثية ، حتى عندما كانت الاختبارات تُدار باللغة الإنجليزية لغير الناطقين باللغة الإنجليزية. خضع المجندون في الجيش الأمريكي لامتحانات ذكاء مكتوبة بشكل جماعي، حيث لم يحمل الكثير منهم قلم رصاص. "علم تحسين النسل السلبي " أجاز القانون أدى إلى جهود لتثبيط أو التدخل بنشاط في تربية الأشخاص الذين يُعتقد أن لديهم "جينات سيئة". في عشرينيات وثلاثينيات القرن الماضي ، ظهرت العديد من الولايات الأمريكية و وكذلك ألبرتا وكولومبيا البريطانية سن قوانين تسمح بالتعقيم الإجباري لآلاف الأشخاص الذين يعانون من مجموعة متنوعة من الحالات التي تعتبر "وراثية" على أساس أدلة قليلة أو معدومة (الصرع ، التخلف العقلي ، الإجرام "الخلقي" أو الفقر ، إلخ). وافقت المحكمة العليا الأمريكية على هذه السياسة ، وهو قول شهير لقاضٍ بارز: "ثلاثة أجيال من الأغبياء كافية'"

ال النظام النازي في ألمانيا ، اعتمدت هذه القوانين نفسها ، ووسعت نطاقها في عام 1939 لتشمل القتل المعتمد طبياً للأشخاص المعتقلين ("Lebensunwertes Leben:" الحياة لا تستحق الحياة) في سياسة الإبادة Aktion T4. تم توسيع الأساليب الفنية للإعدام على نطاق واسع التي تم تطويرها في هذا البرنامج (بما في ذلك القتل بالغاز) مباشرة إلى قتل الملايين في الهولوكوست في الأربعينيات.

تشمل الكتب الموصى بها
كورنويل ، "علماء هتلر: العلم والحرب وميثاق الشيطان"
سي براوننج ، "أصل الهولوكوست"
إس جيه جولد "عدم قياس الإنسان" ، الطبعة الثانية.


4.1 الكروموسومات والجينات والأليلات والطفرات

فقر الدم المنجلي: قصة طفرة من مكتبة التطور الممتازة.

استفسار لمدة 30 دقيقة: طفرات استبدال القاعدة

سؤال: ما الذي تشترك فيه HBB و PAH و PKD1 و NF1 و CFTR و Opn1Mw و HEXA؟

الجواب: كلها اضطرابات تسببها طفرات بدائل القاعدة.

  1. قم بتعيين المجموعات عن طريق توزيع البطاقات التي تحتوي على الرموز أعلاه (لقد درسنا بالفعل HBB ، لذلك لم يتم تضمينها & # 8217t) ونطلب منهم العثور على بعضهم البعض.
  2. أعطهم التعليمات & # 8211 لإنتاج ملصق بسيط ونظرة عامة مدتها دقيقة واحدة عن اضطرابهم ، باستخدام الإرشادات الموضحة في الصورة أدناه.
  3. يذهب. الكثير من النقاش ، الكثير من الأسئلة. إذا واجه الطلاب مشكلة ، فعليهم البحث عنها وتقييم مصادرهم والاستمرار في ذلك.
  4. سيحتاج الطلاب إلى استخدام قاعدة بيانات الجينات NCBI للبدء: http://www.ncbi.nlm.nih.gov/gene

تحقق من أنها & # 8217re على المسار الصحيح: HBB (الخلية المنجلية) ، PAH (PKU) ، PKD1 (مرض الكلى المتعدد الكيسات) ، NF1 (الورم الليفي العصبي) ، CFTR (التليف الكيسي) ، Opn1Mw (عمى الألوان الحساس للموجة المتوسطة) ، HEXA (مرض تاي ساكس).


الطفرة مقابل تعدد الأشكال - الطفرة مقابل تعدد الأشكال (أبريل / 05/2006)

إنه سؤال قديم ، لكن لا يبدو أنه يحظى بإجماع من حيث التعريف الدقيق. ما هو الفرق بين تعدد الأشكال مقابل الطفرة؟

أحتاج إلى التحقق من فهمي .. وإذا كنت مخطئًا ، فهل يمكنني تصحيحه من فضلك. اشكرك

نعم كلاهما تغير ولكن هل من الأصدق شرح ذلك على النحو التالي:

طفرة: تحدث من خارج الخلية: بواسطة عامل خارجي ، وراثي و
لن يكون بالضرورة ضارًا بالمضيف. لذلك فإن الطفرة فردية و
سيحدث في أقل من 1٪ من السكان.

تعدد الأشكال: يحدث من داخل الخلية (أي من خلال التطور تتغير الخلية لتتوافق
إلى البيئة المتغيرة من أجل البقاء. (بعد كل الوظيفة الأساسية للخلية هي
استخدام جميع مساراتها وآلياتها المختلفة من أجل البقاء ، وبالتالي الحفاظ عليها
وظيفتها داخل العائل.)) قابلة للتوريث ولكنها ليست بالضرورة ضارة لـ
مضيف. سيحدث هذا التغيير الموروث في 1 ٪ على الأقل من السكان.

إذا كان لابد من إعطاء أمثلة ، فما هي الأمثلة التي سيتم تصنيفها تحت الطفرات وأيها تحت تعدد الأشكال.

في قشرة الجوز & quotyes & quot: النقطة الأساسية هي الانتشار بين السكان ، وتعدد الأشكال هي تلك الموجودة في نسبة كبيرة من السكان ، في حين أن الطفرات ليست كذلك.

لقد تم إخباري مؤخرًا أنه وفقًا لـ Nature Genetics ، فإن الظهور في مجموعة سكانية هو المفتاح ، إلى جانب ميولها المسببة للأمراض.

فقط لإثبات وجهة نظر متحذلق ، يمكن أيضًا أن تكون تعدد الأشكال وراثية ومرتبطة بالمرض ، ولكن لا يمكن أن تسبب المرض بشكل مباشر

لقد تم إخباري مؤخرًا أنه وفقًا لـ Nature Genetics ، فإن الظهور في مجموعة سكانية هو المفتاح ، إلى جانب ميولها المسببة للأمراض.

فقط لإثبات وجهة نظر متحذلق ، يمكن أيضًا أن يتم توريث الأشكال المتعددة وربطها بالمرض ، ولكن لا يمكن أن تسبب المرض بشكل مباشر

لذلك إذا طلبت منك تصنيف ما يلي بشكل فردي: السرطان ، فقر الدم المنجلي ، التغير الجيني P53. هل يمكن تصنيف هذه الأنواع الثلاثة من المرض بشكل فردي على أنها تعدد الأشكال أو الطفرة.

مرة أخرى ، ينخفض ​​تكرار حدوث الطفرات السرطانية (حتى الطفرات الشائعة مثل BRAC-1) في أقل من 1 ٪ من السكان ، وبالتالي ترتبط معظم الأمراض بمصطلح الطفرات - لأنه من غير المحتمل بدرجة كبيرة أن يكون المرض سيستمر التسبب في حدوث طفرة في أكثر من 1 ٪ من السكان.

بينما يرتبط مصطلح تعدد الأشكال عادةً بعوامل وراثية أخرى تكون إما مفيدة أو خالية ، كما تتوقع ، يمكن أن تحدث هذه الأشكال المتعددة بسهولة في أكثر من 1٪ من السكان.

وهكذا في النهاية ، فإن ظهور الطفرة في السكان هو الذي يقرر المصطلح المعطى - لكنني أقول أنك آمن لربط الأمراض بالطفرات.

وبغض النظر عن الأمر المثير للاهتمام ، سيكون في مجموعة فرعية سكانية حيث يمنح المرض المسبب للطفرة ميزة بالفعل ، وبالتالي يحدث عند مستويات أعلى في السكان أي. أكثر من 1 ٪ مثل بعض المناطق في إفريقيا حيث يمنح فقر الدم المنجلي مقاومة للملاريا ، في هذه الحالة أعتقد أنه سيكون تعدد الأشكال لأنه يحدث في أكثر من 1 ٪ من السكان

في popgen ، يتم وصف الطفرة على أنها حدث فردي لمرة واحدة ، في حين أن تعدد الأشكال هو طفرة كانت قادرة على زيادة التكرار داخل السكان ..
بتعبير أدق ، إذا كان تكرار ظهور & quotvariant & quot أعلى من معدل طفرة التوازن المحايد ، فهو تعدد الأشكال.


شاهد الفيديو: مدخل إلى علم الأحياء. العلوم العامة. مقدمة إلى الأحياء (شهر نوفمبر 2022).